Description :
From Genome Similarity Track
Location :
Scaffold_1256:5127- 6354
Sequence
1227 bases(100 bases per row)
CCAGTGGAGACGCTCCCACAACGCGAACCCGAGGTCACCTTGCTTACCGACGTCACCCCTGAGGTTCGCCCAGATCATTTTGAGACGGCGCTCAATCGGG
GCACGCTTGGAGATGTGCACGCTTGGTTTGAAGTCAACAGTGACAAAGAGGCAAGCTTGAAGAGAATAAAGCTGCCGAAGTTGCTGGGACGGGTGATCAG
GATGCGAATAATCAAAGAACGCTTGGAGACCCTCCAACGTTGTACGCACGGTCAACTCACCAGCTGGGTCAGGAAGCGTTACGCTCAGGAGTCGCTCGAA
TCACTTCTTGGCGTCTGCATCAGTAAACTCCATGTCCACATACTTCAGAACCCCCGGTCATAGGGTGGACGAAGCCGGTACCGAATATCGAGTACCAGAT
AACACTCGGTGAGGCAACGGCTCAACCGACCGGTGCACCGCCACGACGCGGCACCGAAAGTGTAAGTGGCCCGTGATCATGCGCCCAGGTCCAGCATCGA
AAGACCCAAGTAGGCGGACGAGGAGACACCGGAACAGGAGGTGAAGATGCTGGTGCTGGGTGACTTGCCGGTGACGAAGGAGGCGGACTACCGACTATGA
TTGGAGAAGTAACCATCGGCGAAGGATTTGGCCGAGGTGGAGTCGGAGGACGAGCTGGGCCAAGATAGCTCCAGTTGCCGTCGGAACCTTCGACATCTTC
GTCATCGAGTGTGCTCGAATGATCGGTAGGTGGCGGAATATCACCGCCACCACTGGGGGCATCAGGAGAATCATCCACCGAAGGTTCATTATCATCCACG
TCATCTCCACTATCGTCATCAGCATTTCCATCGTCATCAATCTCCATCGAAAAGTCAGGCGAAGCCACGCTTAGGTACGACAGCTGTCGGAACAATCGGA
TCCGGCTTTGAAGACACGGAGGCTGGTGGAGCAGCTTCAACTGGGGCAGGCCCTGCTGTAGAATCCACTCCCGAGACTTCAACTGTCTTGGACGTCGCAA
CAGACGCTGAAGCAGACTTGCCTTGTGGGACAGTGTGGTCCGACTCTTCACCTTCATCACTAGAGCCGAACATGAGTCACATTTCTTCGGCCTCACGCAG
AGCTTCTTCAGCGGCACGTATGTCGGCTGGAGAAGGAGAGATCGTTGAAGCTGGCGGCTTGGCTACATCGGGTGGACTCTGAGGCAGGGGAGAGGGCGCT
TCAGGAGAATCAGGAACATCGTTGTGA