Description :
From Genome Similarity Track
Location :
scaffold_610:5126- 9774
Transcript NameFunction/comments
Pl_103465hypothetical protein PHYSODRAFT_507700
Pl_103466hypothetical protein PHYSODRAFT_504737

Sequence
4648 bases(100 bases per row)
ATGGCTGAGCCCCCTTCGTGCGACGACGCTGCCTACTGGCGGCAGTTCGAGCGCGACTACTACGCGCTACTAGGTGTGGCTCGCGATGCCTCAAGCGACG
AGATCCGCAGTCGCTTCATGTCGCTGTCGCGCGAGTTCCACCCGGATCGACACCCTCGACGCCACGGCAACGCCGCGCTGGTAGCCGCTGCCAATGCGCA
GTACGCAGTGCTGGACAGAGCCTACAAAGTGTTGTTCGACCCGGTGAAGCGCCGTGTGTACGACATCTACGGGGAGAAGGTAGGTGAAGATCGTCTCATC
TTATCAAGGATGTCTAACTTGTTTGGCCAAGCACCGTAAAAGCTTTCTGAAGTGATATCGGGCTCTTTAATTTGATATAGGTTCATGTTGAAGTGGTAGT
GACTAATGTTGGTACTTTAATGTCTAGGGAGTGCATGCTCTGGAGCAGAATGGCCTAGCGCAACAAATTGTTGGCGCGCATCTGAAGACGTCGGACGAGG
TGCAGCATTATGTGGAAGACATCTTGCGTCGCATGAACCAACAGGCTCTAGAGGCTCAATTCTCATCTTTCAGTGAGATGTCCATGCACGTGGATGCATC
GGATTTTGTGCACGCACCAATGCAAGGCATGCGCAGCTTGTTCCACAGCGGTGCAAGATTCGTGGACTGCACGGAGATCACGATTCACCAACGCACTGCG
TTCCCGTTGACTCGTAATACGACGCTGACACTAGGTGGCTATATGTACGACAAGAAGGGGCTCGGTATGGGCAACTTTACGACGCAGTTGGCGTACACGT
CGTTCGATCCGAGCATCCCGTCGTTCACACTTTCGAGTGAGTTGGGTTGGACACCGAAGCTCCACTGTCAGATCAGCCAGCCAGTGTCACCGCATACAGT
CTTTATGCTTATTCCTGAGCTCGATGACAATGGTCTGGACATTTCGATGGGAGCTAATCAGATGCTGACACCTCAACTGCATGGTGCGATGATGTGGAGT
ACACGCGATGGTCTATCTGGTTCACTGAGTCAGGACACTGGAACATACAATACCTCGGCAGCAGTAGCGGTGAATGGTGGAGGACCGAACGTGGCGTTCC
AGTTCCGCCGTATCCTTATGGCTGCGACAACAATCAAACTTTCGCTGCGTGCAAGCCTGGCTACGGGTTTGTCGTTCGTGGCAGGAGCTAGCCGAGAGAT
TTCAAACCGTACGCGATTGGCTTTGGGCGTTCTGCTCGCTCGGGCAGGTGTGACATTGCGTCTGGGCTTCACCCGCGGCAGTGTTCGCTTTGTGATGCCT
ATTTTCCTGTCGCCATTCTCCGCACAAACTGCGTTCTCAACCTTCTGTGCAGCCACCTCACCGTTTGTGGTGGCTGGAGTCGTCACACAGCTTGTGAAAC
CTGCACAGGAGCGTAAGCGCCGCTTGGAGCTAGAGCACCGGCATGACATACGTGTGCAGTACCTCACAGCTGCTCGGCATGGTGCAATGGAGCAGCAGAA
ATTGATGCGTCGGTGTGCAAAGGAGAAGATGGAACAAGAGCAGCAACGAGAGGACGGTAAGGGCTTATTTATCTTGCTGGGTCGCTACGGCAAAAACCCG
ACGAGTCCAGACTCGCGCGAGGCCAGAGGAGATGAGTTGGATATGGCACTCCAAGCAATGCGAGAGCGGGATTTGAATCGTGAAGTTGGTGATGAAGGTG
AGACTGGCAGCGGCGATAGCATCACACAACAAGAGGCGGATGCTGAGCTTCTGGAACAGAAGTGGGTCGATGTTACGATTCCCCTCCAGTTTTTTGTCAA
GGTACGAGATTGTTTTCCTATCGTGGCACCTTGCATGCTTACCATGTTTTTTTTACGACATTCAGGATGGAGAGCTTACTCTGACTTCGTCATCGAAAGC
TGGACTCCTAGGATTCTACAACCCTTGCATCGGCGAAGATCAATCGATTGCCGACGCGCGATCAGCACTGAATTCAGCTGTTAAACCGTTGCTGTAAGTA
TCCTTGTCTGTACGTTGTTATCGGTGACTTCGTGTGTCTCATTTATATGTTGTCCCATTTTGAATTCGTAGCTACGTGCGCTATGCGTACGACGGCCAGG
TATTTGAAGCCACATTCGACGATGACCAAGCGGTCAGTTTGCCGTCAAGGTATGCGCAGGCCATGGGCCCCGCCGGAAGTGTGTACTAGACTGCATGACA
TAGAGGACAAGACCCAGTGCGCTAGAAATTAGGTGTCTAGGATTATGTTGGGATGTTTATACCATGCATGAATTCGTCCACCAGCACGTGCAGAGGCAAC
TCATGAGGTGCCTGGTGTTTACTAGGCTTTTTTGCTGATTGTTCAAGCGCCATGTACTGCTTTGTGAAAAGCACAATCGCGAGTGTATCCAGAAATTCCG
AGAAAACTAGTGGCGTTCCCATGAAGAAGGCGTCGGGTTCGCTATCATGTTTGCTATCACCAGAGCTGGATTCTGCAACACTACGGAGTAGCTCAGACTT
CAGAGGTGGGGAAGACGCTGCAAAAGCTCGGTTGAGGGCTGATAACGCATCACGGACCTGGAAATCCGCAGTGAACACAGGTGCGTTTGGAGGAGCATTA
TTGCGAAACATGATTAACACTGATCGGATGGATATTTCATTGTGCTTGGCGATCGGTATGTGTGCTTCTGGTTCGCCAGGTTCCTGTTCAGACGTGTCTT
CGGACTGACGACAAACTGAAGGAGCAGCACAACTGGTGTATAAGCTTCGAAGATGCTCGAGATGTTTTGTGAAGATACTGTGCAGCTTCTTCCCCATCAG
CTCCGTCCGTAGAAGTGATAACCATGTCGGCGAATTTTGGCCCAGAGTTTCTTGACGCTCGCGCATCAGTTGATCATATAGATCAGAGAATACATCGGCG
AGAAATACCGTGCTGTCGGTGCTCACAGAGAGCTTGATCATACCGTCAGCGTCTGCTGTCGTAACCCACGAGTATGCAATGCGAACAAGTAGTTCGACAA
ATTCACGATAGAGAAGTAATTCGTCCGAAGGCACAATTTCGAGTTGAACTGGATCGACGGGATGTTTGAGACGATTTTCCGCCGGTAGGTCTTCCGTGAT
GTTCTCAATAATGTTCATTGATGATGCACAAGTCAAGGCACTTGCTCGTTGAGACTTTCGGATATCCTGCATGAAACTTTCGAGCTGTCCACTTGTAAAG
TAAAAGCCGCACTGGGACAACAGTTGTCGGCACTCGAAGATTTCGAGAAGTGTTCCAGTATCATCAGCATCGTTGGAGGAAGATGTGGGTCGCCGAGATT
CCTTGATGCATCCACGATACAGTGCACGCAGCTCGGTATTGATACGAAGTGCTGCGTGCTCAACTGCCTTACGAGCTTTTTCACGCTTTGGAATGTCTTC
TATTCGCAACAGATCGTTAATGAAGAACATGATGCCGCTTGTGCTGGAGGAAGAGGATGGTGGCTGGGAAGGTGACAATGCTGGTGCAGTAGACTCAATC
GGTGCGACGATTTGTGCTGGAGAAGTTGAGGGCAGAAGCGTTGTCGTTGCGGCCGTTGCGTAAGAACCTTCAGCGCTACGATCCTGGCGGAATAACCCCA
CGAACACGCGGCCGTCCTCGTAAAAAAAGAGACCGTAGCCTTCTTTGACGTTGGCTTTCCACTCTCCTTCATATCTGGCACCATTAGCGTAGTAAAACAC
ACCTTGTCCATGACGTAGCCCCTCATGGAAGTCACCTTCGTACCAGTTCTTGTCGTGTGGGTTACTGGAAGAGGGCTCATTTCTGCTAGTTGATCCAGTT
GTCAATCCGTTTAGCGGATTCACCAGCCACACGTGCCGTCCAAAACCCTCCTGGCAGTCATTCTCCCATTCTCCATCGTACCTCTCCAACGGGATTGCAT
CCTCCGGAATCGACAGCTCGTCCCCACCACGTGGAGTCATCCAAGTCATTACACCTCGTCCGCATTTGACGTCAGCTTTCCAGTCTCCCGTGTATACGCT
GCCGTCAGCGTAGTGCATGTGTCCTCTACCTTCGCGCTTTCCTTCCACAAACTGCCCCTCGTAGCGGATATTGCGTACAGCATCAAACACCAGCTCACCG
TAACCATGAGGAACTCCATTCTCCCACTCACCGTCATAACGAGCATTGCTACGAGCCACAACAAGGTCTTCGTTGACTTTGTCTCCATGTTCTACATCCC
CTTCACTTTCGTGACTTGAATATTCTTCATGGGAACGATAACCAAAGAACAATGGCTTCGGTGCTTCATCACCTTCTATCTCTTGCTCCTCTTCCTTTCT
CGATTGTAGTAGAACACCACGGTCTCCAGTAACGAAAACTCCGTGACCGTGTCGTTTGCCACATTTCACATCACCAATGTATGAGCTGCCATTAGGCCAC
CAGTACGTCCCTCGTCCAGTGAGTTCATTGTGTGTAAAGTCTCCTTCATACACCACACCGCTAGTTTGCCACTCGATACGTCCTGTGCCGTGCATCCGAC
CTCGAACAAAATCTCCAATGTACGTGAATCCAGTCTTGAACTCTAGTCTCCCTTTGCCATGATATACTGGCACATCACACTCCGCTACTTGCAATGTCTC
CCCCTCATACAATTGCACTACATTCGCCAATACACGAGGGTCTAGCGG