Description :
From Genome Similarity Track
Location :
Scaffold_1343:5126- 6323
Transcript NameFunction/comments
Phyag_g10343hypothetical protein PHYSODRAFT_288743

Sequence
1197 bases(100 bases per row)
TGAATTAACACGTGCATTTATGTCACTAATCGGTGCGAGTGACCACATGTGCACATCAAAATACGGGTCGTCGGCGTTTAAATGATAGGGGAAGGGGCTG
ACCAATACATTCAGCAAGATTAGCGCTCCCCTCATTCTCTCTTTGGAGTTCAGTATACTCAAGCGAAACCGGGTTTTCAATATGGAGCCACTCTCGAGTA
ACGATGCGTCGGGCGCGGCCTGGGCGACCATCAAGACGGAGGTGACcggcggcaagaagcgcaagcgccTGCAGAAGAAAGCCCCGGGCGCGCCCAAGCG
CGGCAAGTCCCCGTACATCCTCTTCTCCAtggagaagcgcgaggagatcaaggcCACGATGCCCGAGAACTCCAAGGTCACGGACGTGATGCGCGCCATC
GCCGACGCCTGGGGCAAgatgagcgacgaggacaagcAGCCCTGGAAGGTGGCGGCCGAGGCCGACAAGCAGCGctacgaggaggagatggcggcCTACG
ACGGCCCGCTGCGCGTGCCCAACaagcgcgccaagaagcaccCGGACGCGCCCAAGCGCGCGTCCTCCGCCTTCCTCTTCTACAGCCAAGTGATGCGCCC
GCGCATCAAGGCCGAGCACCAGGACATGAAGAACACGGAGATCTCCAAGCAGCTGGGCGAGGCCTGGGCCAAGGCCAcggacgagcagaaggcgcCCTtc
gtcgagaaggagaaggtcgaCCGCGCGCGCTAcaagcgcgagatggaggagtGGAACAGCCACAAGGCCGAGCGAGAGTACAACGagagccagcagcagt
acacCAACTATGCCGCCATGACGGGCTTCGACCAGATCAGCTACACGGGCTCGTACTCGACGACGGAGGTGTAAGCAAGAGAGGAGATACAGACGTCTGG
AGGCTTTTTGGGGTTTTGCCGCCTCTGGTTTCGCTTACGACGCTGCGCGCTGGCTGGATGGCTTCGGCGTGGAGGATACAACGCTCCGTGTTACGTGTCT
AGCGCGTCGtcgagcgaggaggaaggtgCTTCTCAGTTATTGTCCTTGCATTGTGTAGCGTAGTGTATCCTTTCTCGCCACATATATTCCTTTAAACTTT
GCATCTACGTCTCTGCCTTGCGTTGCCAAGTGAGCTCGACCATACCAACTGACGACTTCACTCAAGTTCTGGACGATCGCCATCCACGAACATTATG