Description :
From Genome Similarity Track
Location :
Scaffold_456:5124- 12401
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_456-fgenesh-gene-0.5Voltage-gated Ion Channel (VIC) Superfamily
Pytiw_DAOMBR242034maker-piw_contig_456-fgenesh-gene-0.1Novel protein (Zgc:73376)
Pytiw_DAOMBR242034maker-piw_contig_456-snap-gene-0.10Transcription initiation factor IIB
Pytiw_DAOMBR242034maker-piw_contig_456-snap-gene-0.16Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_456-fgenesh-gene-0.3Ubiquitin carrier protein
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_456-abinit-gene-0.38MGC89050 protein isoform 1

Sequence
7277 bases(100 bases per row)
CGTACCTTGCGCAGGTCGTGGACAAACTGGAGCTGCTGGGAGCCTCTCACGGAGCTGCTCGTGGCGGCGGTGCGCAGCTCTTGGTGCTCGATCTGCGCCA
TGATTTTCGACAACTGGCCTGGTCTATTCAACCCATTTCAAAAAACAATCCGAAAATAACGGTTCATGCAATTAAAAAATCATTTTCCAGGCTGTTCATT
GGATAAAATGGCAACTCACTCATTATATTACATTAATATGTGTAGTTTTCGTATTTCGCTTGTTTCGCTTGGAATATTTTTGAGTACTTCCAAACAAATA
AATCTGCCAAAAAGCAAAAAAAGCAAGACAAGGACGAGCATGCTCAAGTACCAGAAGTGGGTCGCGGCGTTCGTGCTGCTGCTCGCGCTGTGGCTGCTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCT
GGGCGACGACGCGCGCTTCCTGCAGCTCGTCAACGTGCTGCCCATGTACGCGCTCGTGTCCTTTGGCGCGTACTCGCTCGCGGTCATCGCGCTCTCGGTC
ATGTCGGTCGAGGACTGCCCCGCGGCCGCCAAGGAGCTCGACTTGCAGGTGATCGAGGCCAAGACCGACCTGAAGAAGAAGGGGTTCGCGTTCTAAACAG
GCTGCGGTGCAAATTAGTAGTGTGGGCGAAGCCAGGACCGGCAAGCAACGCATGAGGCATTCGAGTGGCGTGACGTAGCTCTTCGCGTGTGATTTACGAG
CGTCTTCCTGACAACCAGACCCTGAGCGCGCTGCTAATGTCCAAGCAGAGAGAGAGATAGAGCCACTCGAGAGTGAGAAAGAGAGAAACTAAACATACGT
ACGATTGATTAGCCTTAGGCGCGCAGCATGTTGGTCGAGGTGACGGCGTCATGCGCCTTCATGCGCATTTCGACATGACGTCTCCTCTTTATACCTGCTA
TCCCTCTCTATATGTATAATAAAGAGGTCACGTATGATCTTCTAATTTGTATGAAAGAAAGCAAAATTCATGTTTTTGACGACTATCTTAGAAATTGTAT
GCTGCCACCTGATCGATTCCAGTAATACGTACTTAGGCTAAGTGCGCATTTTCGTTGGATCAGGTGGACCTTTGGGGTGCGAAACCGCTTTTGTGCGAAC
ATAAAGAAAGGAAAGCAGCACCAGCCACCAAGCCTTCTGCGCGCGAGCGATCCATCCGCACGCACCCTTCCCCAGCAGCTCTCTCGAGGACCAGCGCGGC
TTCTGCTACCGACTCGCCCCTCCACGCCACGCTCCAGCTCACGGCGCGTCGTCCGGTGCCGCATTCGCCCAGATCCGCCCAGTGGTTGTCGCAAACCACG
GCTTTGAAAAGAGCCCCTCGGCTGTGAAGCAACCCACAAGCCACAAGCCACACAAGACGCCATGTCCGAGTGCCTCGAGTCCAAGTGCACCGACTGCGGC
AGCATGGACGTGGTGACCGACTTCTCCGCGGGCGATGTCGTGTGCAGAGACTGCGGCATGATCCTCGGTGAGCGAATAATTGATGACACCCCGGAATGGA
GAAATTTTGCTAACGATGACCGTGGGGGCGACCCCGCTGCCAAATCTAGAGTCGGCGAAGTGGCAGACCAGCGCCTGAACGACGTGTCGCTCTCGTCGTA
CCTCGTCGACACTAAGCCGGGCAAGTCGAATGTGGGCGGCGGCGGAGATGCCGGCGGTGGACGAGCTCATAAGCGACCAAACATCTCGTCGGACTGCGCC
AAGGTGAAGCGCATGAAGCGCAACATGGACCGTGTGCACGAAGTCGCAGACGCCATGTCGCTGCCCAAGATCATCGTGGAGACCGCGCTGGACATCTACG
CCGAGGCCGAGAACAAGGGCATCAGCATGCGCGGCCCCGAAAAGGAGAGCATGCCGGTCGCGGTGCTGTTCATCGCGTGCAGAAAGTCGGGTAACGCGCG
GTCGCTTAAGGAGTTTGAAGAGGCCTCGGGCGTGCCGAAGAAGCGCATCGGCAAGTCGTTCATGACGCTCAACCGCAGCCTCGACATTGAGATGACGCAG
CCCACGACCGAGGAGTACGTCCGGCGCTTCTGCTCGCGTCTTGGACTACCATTTAAGACCCAGAGCATCGCGAACGACGTTGCGAAGAAAGCCGACACGC
TGGGCCTCTCGACGGGCAAATCGCCGATCGCCGTGGCCGCTTCCGTGATCTACTTGGTCGCCGCGTACACGGACGTGAAGCGCTCGATCCAGGAGATCAG
CGACGTGACGATGATCGGGGAGAAGAACATGAAGGTGGTTTGCAAGGAGCTCAACAAGAGCCGCGTGGTGCTCTTCGAAGGCGTGCTGATGACGTAAGTT
CTCCCCCAGACGAAGACGAGCAAGCAGCTACTGAGAAGCCGGCGTCGCCAGTTTCGAGCGAGCACAACCAATTAAGACCCCGAGCCAGCCCGCCAGCGAA
GCCCAGCAATTCGAGTCAACTACCCATTTTGAGATCGCCAGGCTGTGCAGCACAACAACACCCCCAGAAGAAATATGAACGACACGAAAACTCCAGGAGG
ACCCAGGACCGCGTGCGTCATGGCTTACACGCCCTCTCCCCAGCACAAGACCAAGACAAGTAAGTAAAACAGGTTCGTACATATTTATAGGCAAAGCAGA
AGACCTCGTCCATCGAGGTGCGTAAGTTGAAATGGAAGAGAAACGAAAAGAAGCCACGAGCCCCACGTGTCAGATAGAGATAGAGAGCAACCGCATGGGA
GAACCACAAACTGTCGCTCACCCCATTGTGCGTTGTGTACCCCAGTATTTTAGAGATTAATAGAAGAAGCAGAGCCCAAGCAGCAGCCAGAGCCGTGAGC
CACAGTATTGGTGTTGTCCAGTCCGCGTGCTGTGTGTAAGAATATATATCGTGAGCATTATCTTATGGCGCCTCACACTGGTTCACTAACTCGCCAGGCA
GTGTTGTATATTTGTTGACTTGTGAACGAGGGTGGATGATGAGATAGTTAATAAATGCTTGTTATTCGTAGACCAAGTGGCAGATCTCGAGCCAGGACGA
GCGCGCGCGCTTGTCGCGACGGAACTTCCAGACGATGCCCCGGTAGAGAAACTCGTCGCGGTTGTTGAGCCGCTTCAGCACGACCTCCACGTTCGCCTCG
AGCTGCAGATATGGCATTGACATACGAATCCGAGTCAGAATGAGCAAGGACACACGAGAGCAACTGAAGCGAGTGCACGATCGTACCTCATTCGTGCACG
GCTCGGGATAGAAGAGTGAGAGCCCGCAGGTTGTGAAGCAGCAGAAAAACCCGCACGCGTAACACGGGAAGCACGGGAAGTAGTCCTCGACAGTCTGGTT
GATCACGTCCATGCAGAATTTGAACTCTTTCCTGGAGACTGCAGTGTTACGAGGCGCACAGAGCAAAGACAGCACGGTGTGAGCTTTACAGAAGCAGCGG
CATCAACGCATCACCACAACCAGTGTGAATCACACGCACCGACGCCGTCGAGCGCACTGGGGAACTCGTGGTCGTACGCCGATGAGAAGGCCGTGATCGT
CGTGGGGCCCGAGCCTTCAAGCCGCGCGAGCACCACTGCATTCTGCTCAGGACTCACGAGTCGCTCCTTCGACATGAAGCGCAAGAAGAAGATCTGCCTG
CAAGTTGAATGATTGGGAACGCGGAGCTGGTGGGGTATCTTTTAAATTGACCTCCTCGCTAATAATAGCTGCTGGAGGCAGATTCGCGACACGACACCAC
ACGGACAGCAGCAGAACGCCACTATGCACTGCAGCGTGGTGTAGGTGCGCTTGGTGAGCGTCTGCTGGCTGTGTCAACGAGATGCCAATCAACGTCTCGA
AGTCACTCGCTTGCTGTGCCCATATCTTGCTCGAAAGGTCGCGAATCATTGCATAATACAGCCTCCGACATTTTAATTAGTGCTATTTACAGGAGCGTGT
TGTACGGTATGCAAGTGTAAATGACGTGGACCACGTCATATCTCTTTCTAGAAAAAAAGAAGGTGCGTTTTGCAGCAACAAATCCCAAAACACGGTAGGT
TCTTTAAAAAACCTTGCTCAAGGCTTTTTTCTCCTTAAGTATTCTGTCTCGACGTCACAACACGGTGTTGCCCACGGTACGTGTTTGTGTTCCGCGCGGA
AGAAAGAACCCACAGAGTTTATTAGCGCAAGTCGTCCATCCAGTCGCCGTCACCAAGCAAGTCCGCAAGCCGCCAACATGTCCACCGCTGCGAGAAGACG
ACTCATGCGCGACTTCCGCAAGCTGCAGAATGACCCGCCCTCGGGCGTCTCCGGCGCGCCCATGGACAACAACATCATGCTCTGGCAGGCCGTCATTTTC
GGGTACGTTCTGCGAAATGGTAGCTGCTCGCCTCTACCGGATATTGAGCTCTTGGATGGTTGAACATGCGCTGTATTACTATGGCAGTGCATGTGGGCTG
TGGATATTTGTACTGACTGACGTCTTGTGCTATGTGGAATAGTCCGGATGACACGCCGTGGGAGGGCGGGACTTTCAACCTGACGCTCGAGTTCAGCGAA
GATTACCCGAACAAGGCACCGACCGTGCGATTTATCACAAAGATGTTCCACCCCAACAGTACGTTGTCGCTACTGCTAGTGTGCCACAAGCAGAGATGTG
GAAGGGCTGCCTTGCTGATATTGTTATTCTGACTGTGATGTATATTTTATTATGATCGCAGTCTACAACGACGGCCAGATCTGTCTGGATATTCTGCAGA
ACCAGTGGTCGCCGATCTACGACATCTCGGCCATCCTGACGTCGATCCAGTCGCTGCTGTGCGACCCGAACCCGAACTCGCCCGCGAACTCGGAGGCCGC
GCGCCTCTTCCAGGAGAACCGTCGCGAATACAACCGCCGCGTGCGGGAGATCGTCGAGCAGAGCTGGGTCGCGATCTCGTAAGCAGAGCGACAACCAACC
AAGCGACCAACCAATTTACAGAGCAGAAAAACAACAACAAGAACAACAGAAACAAAGCAATCTTCAGCTCGGAGCTGCAGAAAAATGGCCTCGGAAGCGA
AAGCAGCGAAGAAGATGAAGAGAGCAGAGCAGACAGAGTACATGGGGCGAATCAAGTTTCGTTGGCGTGTTTGAGCGAGTGAACCAGCGGCGATCCGTCA
GAATGCGAAGAGCTACTATGCGTAAGTCACGAGAGCACGAACGTTGCTGCACCGCAAGTGGCCCCCTGTGAGGAGACGTATTGTGCCTGCTTCCCTAGAT
ACCTAGCCAGCTGCTCACAAGCGGACATGAACTCATTTTAATCGATGACTCTTTGAATACAGGCACAACTCCATTCCATTTCCCGTGAGCACGCTCAAAG
CGTAAATTTTTGTTGTTGATAGTGATTAAATGCCGTCATTATGCAGCGAACGGCGCCTCGACGGCCTCGTCGACGCTGTCCAGCAGGTCGTTCGAAGCGA
TGTTGACAGGGTTGAAGCTTGCCTTTGTGGAGATCGTGCCAAAGGCGGCGAGCTGGATGTCGCAGCCCAGGTCGCGCAGCGCCGCGTAGGCCTCGTCGCC
ACAGCCACGGTACTTCTGCGCGTCGCGCAGCAGCGGCTCGATGTCTTCGTCCAGGATGCGTGCTCGGAGCTCGACGCAGCGCGCGACCATGTTGCGGATC
GCCAGGCTTGCCTGGCGCAATAAAGCCGTATTCTCGCTGTGTGTGCGCATTGCAAACGCAATTTGGCGAGCGCCACCCAGGTTCACGATCTGCATGCTGT
TCTCTGGCGAGCGCAGTGCGATCGCAGCCAGTGTGGCACATGCGTGCTGTTGGAGAGATGCGTCGCCCAGGTGCAGCCGCATGCCCGTGAGAACGCGCTC
GAGGCCGCCTGACTTGATGATGTAGTCCTTGAGCTCGTCGGCCGCGGCCACGTTGCGGTACACGGTGATGCAGCGCTTTACGACACCCAGACTCCTCTCG
TGCGTGATCATGACTTGCTGCAGCAGATCGAGTCCGTGGAGGTCGTAGATCTTCTTGCAGTTCTCCTCCGTGATCGCAAGCTGCTTGAGCACGATGAGCC
ATACGGTGAGCATCTCGGGCTGATCCGTGTGGGTGCGCACGAACTCGATAATGTACGCGATCACGTCGTGCGCGATGAGCTGCTTGATCGTCTCCTGGGC
CTGCGAGAACGTCGCCTTCTCGTCGTCGTTCGTGGTAAGTGCGCGCAACACGAGTGCGAGGTGCTTGGAGAGCGTCTCGTCCTGTGTTGCGCCTGGGAGC
TGGGCGCAGAGTACGTCGACGCCATTCGCCTTGGTAAAGTGCGTCTTGTTCGCCTCGTGCTTGGCGCAGGTGACACGTACGACGTTAAGAACGCGGATCA
CTGCGGCCGAGCTGCTAGCGCTCCTGTGGAGCTTACGCAGCACGCCCGCTAATCGCTCCATGCCAGCCTGTCCGACAAAGTCCTGATTGTCGGCGTTGTC
TGCGCACAGGTACGCCAGCAGCACGCTCGCCTTCTCCAGCACCGCCTCCTGTGACAAAGCAGCCGCGTCGATGATCTCCATCAGCGTGTCGACTGCGTTG
TTGCGGCCCGCGACCACTTTCGCTTCCGGAATTTTATCACAAAGCTCCTGCAACTGTGTGAGCTTGGCCAGAAGCTTGGCCTCGTCAGCGTCAGCATGGA
GAGGCGCCTTTGACAGCGCGCCGAGCTCGCTGATGACGCTCTTGATCTGCTCCAGTACGCTCACAGTCTCTGTGCTGTTGTCGCCGTGAGCATTGCCACC
AGTGGCAGTGCCGAGCGAGACATGCTTGATGATGTTGGAGAGGTCGACGCCCTGCGACTCGAACTGCTGCACGGCGTCGCGCGTGGCCTCCTCCAGCTCC
ATGTCAAACTCATCCACGTTCTCTTGCACGGCCTCGTCAAAGGTCTCCTGCGAGATCTGCCTCTTCTTGTGCTTCGTGGACGCCATGACGCTCCTTCGTA
GCTCTTCGCTCGTGAGCTCTTCCTGATGCTGATGACCAAAATGTGTGTTGCACCAGAAGGCGCTACCTGAGTAGAAACGATAGAAACTATTATTTAGAAA
TGCCAGTCTTACAAAGGGCAACAAATTGTTTAGAAACGTTTTTTAGAATGCAAAATCGTTTCTAAACAGGTTGCCTC