Description :
From Genome Similarity Track
Location :
scaffold_19:51232- 52700
Transcript NameFunction/comments
g10838.t1 hypothetical protein PHYSODRAFT_340835

Sequence
1468 bases(100 bases per row)
TATTTGATGTTTATGTCTTTTCTATAGAAGCCTTTTGATAATATAAAAGACGCGACTTGATGTCGTTCATCTGTCTGGGTGGCGTTGCTTCTGGTTGATC
TCGTGGTTTGAAGTTTGATAGGTAGCTGTGCATCGGGTCTGTTGTTGTGCTGGGTTGTTGTAGGTCAAATTGTCGAGTCTTGTGGGTTTGTGTCAGTGTC
CGAACTGCTTCCAGGTCGGCTTTTGCTGGTGTGCTCCATTGCACAACGAAGAAGCGCTGTAGCTCTTGATCCAGTTCCTGGATGAGGCTGTCGCTCTGTG
TTGTCGCTGGTTTTGCACTGAGGGACTTCTGGATTGTTTTATCCACACTGTCACTTCGGAGGTACGTCTTTGCTGCGTCTCCGAGCTTCTATAGTAGTGG
TGAATGGATACAAGAATACCATTATACATATCAAAATGCTACAGGCTTGGCGCCTCGAAGCTCTATGTGCTGGAGCCCCACGCATGGTGATCAGCATTGC
CTCGCACTGCAATTGTACTATAATTTGTAGTGGGGGGTAGAATCTACCTCAGTCGAAAATCGGCTCGTCGCTCCACTCGCCCTCGGACCACCACACTTCC
GTGTCTGAATTCGCGTCCGACGCAGCATATCGCCGCCACTCCGTACCGTCGTAGTCCTCCACCAGGCCGTACTCATCGTAGCCGTCGCTCTCGTCCACAG
GACTCGCGCTAAACGACCCTGCAGACTTGACGGATCCGCTGGATGCGCTCGCGCCATCGGAATCGTAGATAGCGAACCACTGCAACTGCCGCTGCACAAT
GTCCACGTTGCCCGCACACTCCTGCAGCATTTCGTCCACAACGCCGTCGTAGGCAAACGGCTCCTGCCCGAAGTTCACGTGGATGGCGTCCGACGAGTCC
AGCCCGACGGCCGGATACCACTGCTCATGCACGCACTCCATGGCGCTGCCTTCGTTGCCAATGAGCTCGCCATTGTTCGTGAACATGACAAAGGAGCGGC
CATCGCGCACGCTTCGCCGCACGCCGCAGCCGATGGTATCGCTGGTCCCGAAGGCTGGGCCGAATTGTCGCCCGCGGTTTGAGTGGAACATCTGACCGTC
GTCGCCATGGTATCCGTAGGACCGGAAGTCCCAGCCAGGCTGTCGGTCGACGAGCGGAAAGCGCGAGGTCACGAGGCCGATGGACGTCACGTCCTCGCCG
TGTACTCGTCTCGCCGAAGGCTTGACGCGCTTCGTGACGGAGATCTCGAAGTAGCCGCTGGACACGACACCCACGTGGTACTCGAGCGCATTCGTCTGCG
GGTTCCTGCGCTTGAACACTGCGACGTGGAACGTCGTGGGGAACGGCGCATTGGACCGCACGCAGCGGTCGTCGCCCAGGATGTCGCCGTCAAAGCCAAA
GTCCACCACCTCCGTCGGCTTGATTGGTTGCGCATGAAGGGACACGACACTGCAACTCGAAGCCAAGA