Description :
From Genome Similarity Track
Location :
contig_126:51222- 54545
Transcript NameFunction/comments
g11492.t1hypothetical protein PHYSODRAFT_510782
g11493.t1hypothetical protein PHYSODRAFT_510782

Sequence
3323 bases(100 bases per row)
GTTGGTCTCGGTCTGGGCGGCACCTCCGGCACCATGCTCGCCATCCTCTTGGTGGCACTCGCGGCCCAACTGAAGCTCGACTTCTACTTCCCGCCGCTCT
ACTGGTTCGTCATCGTCGCCATCAGCACTGTGGGCACTCTGCTAAGCGACAACCTCACGGACAACCTCGGCGTTTCGCTGTCGGTGACCACCCCCATCTT
CCTCAGTCTGCTGGGGGTTGTGTTCCTGGCATGGTACCATTCCGAGAAGAACTTGTCCATCCACAGTATCTTCACGCGGCGTCGGGAGGCGTGGTACTGG
CTGACCGTGCTCGTCACCTTTGCGTTGGGGACGTCGGCGGGAGATCTCATCGCAGAGAAGCTCGACGTTGGCTACGGAAACTCGTTGGTCCTCTTTGCAG
GTTGCATCCTGTTCGTGGGGTTACTATGGCGGTTCAAGGTGATCAACGGGGTGCTCGGCTTCTGGGTGGTGTACGTGCTGACTCGGCCGCTCGGAGCCTC
GCTGGGAGACTTGATGTCACAGAACCCGGCGGACTCGGTGGCCTCGGCTTCGAGCTCCGGGTCGGGCTCATCATCGGCTTCGGCTTCAGCTTCAGCCTCC
GAGTCGATGTCTGGGTCTGGCGAGACGGAGGAGCTCCCTTCCGGTTGGAAGACCGGCCTCAACCTCGGCACGACGGTCACGAGTATGATCTTCTTGGCTC
TCATCGCAGTGTTGGTGGCTTTCTTAACCATCACGAAGAAGGACGAGCTGAAGGTCGAGTCTATTCACCCTGATCTCGAGAAAGGGGAGGAGCCAGGGGC
TACCTCGACCACTTCAGTTCAACACGAGTGGACGACGCTACCCGACAATGCAGCGCGGTAGACTGTCTTTCAAACTGTGAAGGTACTTTCCCACTAAGAC
CAATGCGTCGAATCTCAAAACCTACAACACCACCCTGTGCATTTGAAACTTGCTTCGTTATACACAATATCAATACGTCGAAAAGAAAGCAAACGAAGTG
TATACTTCGTTTATACGCATACTGCGTTGAGGATTGTTTTGCTATGAATACGTTTGGCATACATGTCCCCGCCTACTCCACACGAGTGATCGGTGCCGAC
GGGAGCTCGCTCTTCCTCGAGCGCTTGCGCTTGCGCAGGAAGAAGGTTTTGAGGTCGTGTTAAGTAGTAGTTTGAAGTACTACAGCAGCGTACATGGTCA
TGTTTGTAATAAAAGGAGTTAAAACCCTTGACCAAATTCGTGATCAATTTCAAACTGCCGCTTGCGAAGCCTGGACAATCGTCAACAACAGACAAACCTC
TAGCTGGATCTGAAGTGCTGGGTGACAAGGGAGCTATTTAAGCTACAACAATATAATATATAATATAATTATTGGACGCTCCGCTTGTGTAGCAGAGTGA
AGGTCGTACAAGTTGAAGTTACAGTGCAGTAAGGTGTTTACTTCTGGGTATTTTTTTCTAGTTGCAGCTGTAGAGCGACGTTGGACACAGATGCCAGCGT
AACATCCTTTGGTTCACAATCGGCGCCAGCGCAATCGCATTTCACGTCTGCACTCAAGTGTCCTAACCCTTTTGCATCGTATTCTACGAACAAACAGGGA
AAATGGAGTCTTCCTGACAATATGGATAGGAACAAGTCGTGTTGTTACGCATCGATGTCCAGCCATCCCAGCTCAAGAGCCCCAGGAAAAAGTGCGCCAG
GATTACCTCCCACTCCAGAATCCACAACATGTAAGCTGTTTGTTTCATCGGACCGTCTTCGGAGTCTGATGCTTCAGCGGAGGTAAATGCACACGCTGAA
CAAACCAAAACGCGAAACGTTCAAGAAATTGTAAATTACGTAGGATTGTGAACGAAATATACTCGATTCGAGTCAGATTTCAAACCTCAGCGGACAGATT
TGGTGTTCAGGGTGTGGTAAAATCTGGGCGCTAAAAAATCTCGGCATGGTTCTCTTTGTCAGTTTTGACCGTCGTTCCAAGCGATGCGGTAAGCTCACAA
GCAAGATGGGTTCAATGTGAGATCGCTTGGTTCAGAACTTACCACATATTACAGCTGCAAAACCACTGGGTTTCCAGTCCCCCGGCTCAAAACATGCGAT
TGCGAAGCCTTCCACCAGCGCTTCGAGTTATCATCAACGGCCCGTGATACCCACACCGACCGACTCGACTCGCCCGCCCTCCACGATAGCACCAATAGAT
AGCACTTCAAAGTTGCTGTTCGAGCAGCAAAAGCCTCTTCCGACTCACACCTTCGCCAACCGCTATGGGCTTCTTCGACGAACAAGTGGGCGTCAAGGTG
CCCCAGGTCACCGTCTACTTCTGGATCATCAAGGTCCTGGCCACGACGGTCGGCGAGACGTTCGCCGACTTTCTCAACGGAAATGTTGGTCTCGGTCTGG
GCGGCACCTCCGGCACCATGCTCGCCATCCTCTTGGTGGCACTCGCGGCCCAACTGAAGCTCGACTTCTACTTCCCGCCGCTCTACTGGTTCGTCATCGT
CGCCATCAGCACTGTGGGCACTCTGCTAAGCGACAACCTCACGGACAACCTCGGCGTTTCGCTGTCGGTGACCACCCCCATCTTCCTCAGTCTGCTGGGG
GTTGTGTTCCTGGCATGGTACCATTCCGAGAAGAACTTGTCCATCCACAGTATCTTCACGCGGCGTCGGGAGGCGTGGTACTGGCTGACCGTGCTCGTCA
CCTTTGCGTTGGGGACGTCGGCGGGAGATCTCATCGCAGAGAAGCTCGACGTTGGCTACGGAAACTCGTTGGTCCTCTTTGCAGGTTGCATCCTGTTCGT
GGGGTTACTATGGCGGTTCAAGGTGATCAACGGGGTGCTCGGCTTCTGGGTGGTGTACGTGCTGACTCGGCCGCTCGGAGCCTCGCTGGGAGACTTGATG
TCACAGAACCCGGCGGACTCGGTGGCCTCGGCTTCGAGCTCCGGGTCGGGCTCATCATCGGCTTCGGCTTCAGCTTCAGCCTCCGAGTCGATGTCTGGGT
CTGGCGAGACGGAGGAGCTCCCTTCCGGTTGGAAGACCGGCCTCAACCTCGGCACGACGGTCACGAGTATGATCTTCTTGGCTCTCATCGCAGTGTTGGT
GGCTTTCTTAACCATCACGAAGAAGGACGAGCTGAAGGTCGAGTCTATTCACCCTGATCTCGAGAAAGGGGAGGAGCCAGGGGCTACCTCGACCACTTCA
GTTCAACACGAGTGGACGACGCTACCCGACAATGCAGCGCGGTAGACTGTCTTTCAAACTGTTGATGGTACTTTCCCACTAAGCCAATGCGTCGAATCTC
AAAACCTACAACACCACCCTGTG