Description :
From Genome Similarity Track
Location :
scaffold_61:51213- 52271
Transcript NameFunction/comments
Pl_110786HECT E3 ubiquitin ligase, putative

Sequence
1058 bases(100 bases per row)
CCGGTTGAAGCACGTGTGCGCTCGCGGATACAAACACTCGTCAACACTGACGCACTGGATCGCGAACGGACAGATGCGTCCGTCATTCATTGTTAGTGCC
TTGAAACCTTGCACTGGTACACGAGCCGAACCAGTCGTAAACTGCAATAAGCGCGCCTTCTGCTCATTCGAGAACTCATGCACGCTATTCCAGAACCAGG
CGATGGCCCGCTCGTCACGCTCCCCCACATAAATAGTGTGAGTCTTCCAGTCTAGTACATCAATGTCGGGGATTCCACAAATCAAGAGCTCCAACTCCTG
GTGGTCGAAAACGGAGAGCAGCTCTTTGGGAATAATAGAGAAGAGTCCTTGCATCAATGAACCAAGCTGTTGAGATATGCTGGTTGCAATTATCCATCTG
AAGCGTAGGTTGATGTACTCCATCTTGTTTTCTTCTGTCACAGGAATGTTTGAGCCATTTGGGACAAGGTCCACCACCTTCGACTTGTCGGACATTTGAT
CTACATTAACCCTATCATAGCAACACAACATGCTCAGTTAGTTCAGCAAAACACGATACATCATTCACATCACACAAAAGCCACGTACGTGAAGTCCAGC
GCCAACGACTCCACGCCAGTGTTGTCGCGCAACCACTTCAAATTCTTGTACAAGTCGTTGTCCACAAATTCAAGATCCGAAAACGTAATGGGAATACCGA
GAATATGCTTGCACACCGGTAGAGCCAAATGTGCGTCGATCAGAATGCCTTCGAAAAGTGCTCTGCCGATAAATCTCCCGATAGCTTGGTAGTACTGCAG
CATACAGACAAATAAGGTGAGCATACACGAACTCCACGGCATGAGCGCATAACTTACCATGAGGTGGTCAACACTGGCTTCAGCAGACGCTGGGTTGATC
ATGAGGCCATCACCATTTCCGCTTCTGTAAAACAAGCCCGTCGTATCATCGAATACTTCCTTCGTCATCAGCGTAAACCACTCGCGCACTAATCCGCCTG
CATCTACACCTGGCTCATTCGCAAACTTGATTCGAAGCGATTGATGCAGCTGATCCGG