Description :
From Genome Similarity Track
Location :
Scaffold_1549:5121- 6200
Transcript NameFunction/comments
Phypl_g13685hypothetical protein

Sequence
1079 bases(100 bases per row)
CAAGAATGGATGCTGTAATAGACCACCTTCTCCGTCAATTGGCGGTCGGAGGCGATGATCTCGCTGCAAACAGGAACAAATCACGTCTTCCAGGTCCTTG
TTCTGCAACGGCGGAAACGGAATAGGCACTGACGGATCGATAATGCAACGAAACTTCTCGATGATGCTGTGCACGTCCCCGAACGGAGGCTTCAAATACA
CAATCTGGTAGAGAATGCATCCCAGCGACCAAATGTCACTTGCGCGCCCAACCTAACCATAAAAACAATGCGAGAATATGGGCGTAAGCCTTGACCTTCG
TTCATCTTGCATGATGCTTTTCAGGCGTACCTTCATCTTTCCTTGCGGATCACGCTGACCATTAGGAGCTGTGTTGCCCTGAATTGCTTCCGGGGACATG
AAATTGACCGTACCAATCTGGCTATCGCGCTCGATATTTGTAGTGTCGTTCGAGATTGTCTTCGCGATTCCGAAGTCAATCAGTTTGAGCGCACCATTCA
CAAACAGGAAGTTTGCCGGTTTCAAATCGCCTAAAGTTAAGCACGCAGAAAAAGGAAACCCCACGTGTAAGCACGACCACTCTCACCACATTGCTAGCAA
CCATGTCACTCGTACCATGAATAATTCGCTTTTGGTGAATGGCGTTCACAGCTTTGAGCATTTGCGACCAAATTACTCGCAGCATATTCTCATCCATGTT
ATCCTTCAAATCGCGAAGCCGCTTGCTAAGGTCGATTTCGCCGTGCTCCATTATCTAACGCACGACCACATCAAGGGTAAGTTCGGTATACGCACATATA
CCATAGATGTCATGCAAGAACATACCACATTgatctgccgctgctggaggtccTGCTCGGCAGCAATAAGCGTGATGATGTGCGGGTTCCCTTGCAACAT
TTTTAGCAGCTTGATCTCATTTGTATACTGGGCGATACTTTGCGCATCCAGCTTTTTCAGCTTGATTTTCTTCAGCGCGTAAATCTTGAGATCTGGCCCC
AGCATCCGGTAGACTTTGCTGCTCCCGCCACTTCCAATCTGCTCCAGCTTAATATACTTCTGCCCATTTACCTATACAT