Description :
From Genome Similarity Track
Location :
Scaffold_12:51207- 55696
Transcript NameFunction/comments
Phyke_g2276oligopeptidase A, putative
Phyke_g2277hypothetical protein PHYSODRAFT_353702
Phyke_g2278hypothetical protein

Sequence
4489 bases(100 bases per row)
TGCCGCTGCTCACGCAATACGGACTAGCATCTAAGTAGAAACCAGTAACGTAGCGCATTGAATGTGTTAGCGTCATGACGCTAATTCACAAATATGTTGA
CTTTGTCGATGCTAATTGCATTTTGGTTTCATTAGCTTTCAAAGATTCGGTCCTCCAAGAAAAGTGGGTAGGCACATTGTAAGGCAAAGCATGTCCGTGG
CAGACTCGAGTGTAGTGCCATGAGATCGTTGGCTTTGAATGCGTGCGTCAAGTAAAATGGGAATCGCCTAGTCGTGCGTCGTTCAGGATTGGATTACTAG
TGTTGGTGGAAAATTGTTTCGTTTATCGTGTTCGTGGTGTCTGTGACAAGGTTCATCATGCGTTCGGACGGTAGTAAGTATTAACCGCACAACGCCTTGC
ACGTTTCTGGTCAACGCCTTGGCATGGGTCGGTTGAATGTATTAGCCGACGTGTCTGTTCAAATTGACGAATTTCGCATTTTGTGTTCGTCGGTTCTTTT
CAACTGCGTTTTCAACTGCGAATCAGGACCGCAACTTCAAAGAAACTCTCGTTGAAGTTGGGTCGGAATCAGAGACTCAGAAATCTGGAACCCCATTCTA
CTCTCTGGTTGGTCAATCGCTACTAGGGTTCATAGAAAGCGCCTGCGCGTGTCGTGAGCACATCACATTCACGAGCGATCCCCAAGCCTTCATTATCCAA
AAAGCATTCGTGGTCAAAAAAGCTTTCGTTAAAGACGAAAACTTCATCCAAAGAGACCAGATATCTACCCTGCTATCTTCATCTACTCAGCTACCCAAGC
ACAAACGCACTGGAACGCGGTtcaaacacacacacacacactacACCAATACAACACAGAAATCAAGACAACACACAAGAATGCTGTCGGAATTGTTATC
CTCCCTGCCGTCACCCACACCGACGCTCAGCTCACGCCTATCACACCTCAACTCCTTCGTAGTGCTCACCAAAAAATCATCCCCCAGTAGTCGCCGTCTA
TCGCGTCGATCCAGTGTCGCCAGtatttgcagcagcaccagcaccgccagcaactccagtgacgacgagTCGGAATCATCCGATCTGGACGGGGACGACT
GCTGTCTCGCCTACGAGTCTTACGCTGCAGTGACCAAGCGCAATAACCTGCCGGCTACCGCCCGTTCATCATGGGATCTTCGTTGGAGCGACTTGCAACT
TTCCAAAAATTCAGCCGAAACCTCGAAACTATTGGCGGCGATGCGTCTGAAACGCCGCCACACCCGCAACGGCGAAGCCTTGGAGCTGACAGCACTGGAA
TTGTGCTTTGAATTCCTCACGTTGGAGGAACTGCATGCGGCTGCACTCGTCTGTACGGGCTtccacgacgtcgtggtaTCTTCAGAGATGCTTCTCAGTG
GACTGTACACGCGCCAATGGCGACGCGACGGCAAGATGCTACCGGCGACGTATGTGATGCTACCGTACTGCGAGCAACTAACACTTTGCGCTGGGCGTCG
TACAGACACGAACTATGAGCTGTCGACGCGCAGTGCTGTTACCCACTTGCCTGATGGCAAGTACAAGGTCGTGAACAACTCAATGCTGCGAAACTTCGAA
AAGGGCGCAGTGGACTCGGTCCGTGGCGTGAAGTCACTCCCTGTGTTGTCCTGCGCACTCGCCCTGAATAAGGGAATCTCATACTACGAGGTGGACATGA
AAGGATGCGGAAGCGTGGGCCTCGCGTCGCTCTCGGACGCGGCGGCTCGGAACGCTTATGGCTTTGGCTCCGGAGAGCACGTAGGCTGGAAGGGCTTGTC
CTACGGTTACCACGGCAATGACGGCGACTTCGTGTACAACGATGGCGAAAAGCCATACGGTGGTGCGTGGGAGTCTTTCGGCCCATCGTGGGGCCGAGCT
CACGCTCGGTTCGGAAAtcaagaggaggaagaagaagaggcaCCTACGTTCACTGTGGGGTGCGGACTAGATGCCGACAAGCACCAGGTCTTTTTCACCC
TGAACGGGGAGCtggttggtgcagcaccGACTACGGTGTTGCCTGGTGActacgctgctgctgtgtcgCTTCACGCCtttggcgatgaagctgtcgtcAA
TGTCGGAGCGGCCCCGTTCCTTTTTGACATCGAAGGTTTCTGTGCAAGCCCTTAGCTTGATCTTGTCTTCCGGATTAAGTTGAGGGCTTGCACAGAGGAG
TACAGAAACCCCTTGTGGACCCCGCCGCCGCCGTCAGTCGGCCGCCTCAGTCTATTCTTCCCTGCATGTGTCAACGTATCTTTATTTTGCTTAGCTAGCA
GCATCGGTGGCAGATTCTGAGCCACCGCTTGAAAACTGACCATTAATAATGAATTGTATCTCGTGATTTTAGTGTTGATACTACTGGTTTGTTGGGCTCT
AAGTTCTGCTATGCATGTAAAATGTATTTGCGACCTTGATTTACATCGCAGCAGTTTTGTTGGCGGGTTCGTCGTTCGTGTCCACGTTCACGATGGTGCC
TTCGACTTCGTTCTCAGCGGCATCTTCAGTGTGTCGTCTCTCTTCGTTTGAAGTGATTACTTCTAGTGCGAGATCACACATATCGACGGTTTTGATTGAC
TCAATATTTGCTCTGTCTCGGTCTTTCTCGTCAGCGAGAGTCCCGTTAACCATTAGCATCGCGTGTTCTTGGTTACTCGAATTCTCCTGTTCCGCAGTAT
CCACCTTGCTTTCGATGATTTTATCTTTGGTGGAGCTGGCCTCAGTGCTTTCACGCGTAACGAACGATTCGCGATACGCTGTCGTTGGCGATGACAAAGG
CGACCCGAAGCGCATGAAAACTTTCAATGCTGTTGACGCCATTGACGAAGGGACCGGCGAGAGCGTCCGCGTTTCATTCAAACCGTGCGTTGAGATACGG
CGCGCGGTCCGATTGATTTTCTTGGACGCCTCTGAGATTGCTTCGTCCATGAGTCGCATCCACTCGGCCTTCGAGCTCGAACTGTCAGCAAACACAACGA
AAGACTTGACTGGGTTTTGAATCTGAAATGCGTTCTTGGATAAAACCCCATCGGAAATATTTGAAATGCGCGTGAGTTTGAGTCGGAGAGCGTTGTGCGG
GCTCCAACTTCCGGTCATACTTCTGTCAGCGTACAGCAGTTGGTcattgaagaggaagaaacgGTAGACCTGGTTGCGAGACCGACACTTCTTGGTCAAG
TCACCCTCGTGAATAAAAGTCGTGGAAGTTTTCAGGTAGAAGTTACCACGATGAATGCGCTGAATCACCGAGTCAAGCTTCTCAGATTTCTGTCGGACCT
GTATTGTCTCTTTCATATCGTTCACGAGCAGATGAATGTCCCCCATAACCTGCCACGGTTCATCgctcgcagcagcttcttgaatACTGCGAACCCATTG
GTACTTCTTGTCGAGCGCCTTCTCATTCATAATAGGGTCACTCAGCTCCTCTTTTTGTTCGTTTCTATCCTCGTGGGCAGTCCCATCCAGTGAGTCTTGC
ACCTTTCGTAGCAACCCGCAAAATGCCTGTCGTTCAATGGGCATGCCTAAAAACAAGCACGTTGATATGCAAAGTCGCAGCAAGTCCAGGCACTGCATTT
GCGTGGACAAGTCCGACTGGCTATCGCACAAAATTGACGTCGACAGCGCAAGTAGGTAAAACCACACGCGCTCGAAGAGGATTTTGATCAAGTCCGGGCT
GATGGCAGTGTCGACACCGACAAATTGGAAGGTATTGTACGCGTGTGACAAATCCTTCATAAGTTCTTCTGACTGGGCCACAGCCTTAGAAATACCACTG
CGAAATTTCTCGTTCTCCaggtctgctgctgtgacgCTGGCCTCGCGAGAGGCTTTAGGGATACCGCGGCTTCCCTTGATGTGCATCGGATTTTGTGCGA
TGTCGCCGTAGATTTCCTCGAGAAACCGCTTCGGTAAATCTTTCCCGTTGTCGATGCCTCGGTTATTCTTCACGAACTGCTCCTTTGTCATCTTGTTCTT
TTTCACCTGTGGGTTGTGCAGATCCGTGTTGAGCATAATGATTGAGTATGCGATGATCATCGCAGTATCGGCAGATGAGAAGGCTGTCGGCGAATCGCCC
ACGTAGCACTGTGCGAATGCTTCAACCATGCGCTCTATTTTTTGCGCTTCGCCTGGGAGCCGGAACCCTCCATTGGTTAGAAAATGCCGCAATGACTCCA
CTAGTGTCATGCCCTTGAACGAAATCGCCCGAACATATGTCAGTCGAACCTGGACTTTAAAATCTTCGTCGCTTTCGCCCAGGTAATCCCCGATTTCTGC
CTCGTCAAAGAAATCGTGATAGATTCGCAAGAACGATGTAATACTACGTGGGGTATCCTTGATGAAattcatcgccaccaagtATTCAAGCGCCTTCTTA
AGGCTCTTTGAAGATGAGATCTCCATCGCTCGCTTCAACAGTTGCTGGTTGTGTTTCTGTAGTTCGTTTCGCATGCGAACGGAGTTATT