Description :
From Genome Similarity Track
Location :
Scaffold_254:5120- 11003
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_254-fgenesh-gene-0.2Pumilio-like mating protein M90
Pytiw_DAOMBR242034maker-piw_contig_254-fgenesh-gene-0.340 kDa peptidyl-prolyl cis-trans isomerase

Sequence
5883 bases(100 bases per row)
GCTTCCAAGACGCCGCTTCAATGCACTTCTGGAGGACATGGTTGCCGTTCTGGTCGGTGATGCACTTCAGAACATGCCCTCTTAGCTCCTTGATCAACAG
TAGCTGCTCGTCGACTTGGGTGACTTCCAGTGCCTTCTGGATAACTCGGCAACCGTACACTTGAAGAGCGAGAGTGATCAAGTTGGTCCTCATCTGCTCC
ACCAAAAGTTGCTGCTGCTTCACTGATCCATGCTCGAAAAACTTCTGGATGACGTAGTTGCCGAAGACGTCCGTCATGAGGAGAAGCGCGTTGGAAGAGA
TCTCTTCGAACGCGTCGTCTTTGGTCTCATCGTCTGCCTTCTCCAACTTCTGCTGGATGAATCTGGAACCACTTTGGTCTCTCGCGAACAGCAGCAAGTG
CCCCTTGATAGCGGACAGTTCCCACTTGTCAGACTTGGAAGCCGAGTTAAACTCTTCAAGGAGACTGTTCGATGAGTACGAGTGCGCGACCGGGTGCACC
ATCTCGTAGTCAGCTCGGCGGCTGGATCCCGACTTCGAGCGGTAAAGCGCGCTTGGGTGCGGGACAGCGTGTTGATACGTGTCGCGAACATCAAACCCAT
GCACCGATCGAGGAGTCGTGTACGATGGGTAGTCTCTGTCTTGTCGCTCAGATGCCTTCAGAACTTCATAGATACCTCCAGTTCTGGGCTGATAGTTGGA
AGCAGCTCGGCGACCTGCAAAGTCAAACTTGGTGACGGGGGCGCCAAGTGAGGCTGCACCATTGTAGTACGCGTTGCCATTCAACTCCCACGGATGCTTC
AGCTGGTCGCTTGGGCGTCCACGGTATCCAATGGGTGGGTGCGGGTGAACTGCAAACGGCGACGGGCTCGCGTATGCGTTGGAGTACGCTGGCTGGCTCA
CGCTTCTGTTAAGCGACCGGCTTTGCTGATACCCCGCGAAAGGGAACTCTCGAGCACCTTGGCTACCAGAGCGCAAATCACCGAACGAGTAGCCTGGCGG
GAGTCCGAGGCCATCACGGTGGTATCGCGGTTCGTCGCCGAGGCGCAATGTCTCCATGCCTTCAATCTTGCCCCCCGCGAAGAGCGAGTCGCCGTCATCG
GCTGAGACTGGATCATAGGCACGCGTTGGCGCATTCGAAAACTCCTCTTGAAGACTGCCGATGAGCGACAGCCCCGGTGGCAAACGGCATCCTTCGGAGC
TCTCGCCGTGGCTTGAGCTCACTGAACACGCCGAACTAGACACGTTTGAGCCTTGGTTCGAGTATCCCGGAGTGCTGTCGTACGACAGGTCCGAGACCAC
ATGGGTATCCGAGTGGTCAGGAGAGTCGCACAGGAAGCTGTACTGGCTTTGCTTCGACGGATTGCCCCAGACGTCGTTCATTTCTTCACCGGATTTGCAC
AGCGCAAGGTCCTTGCATGTGAGATTGCCCTGAAAGGAAACAGTCAGTAAAACAGTATTCTATATCCAGGAGCGTGACGGAGCAGCACTCACCGAATCCA
GCGGGACAGGGTCATCCACCTCTTCTTGGTTATCTTCATAGATTCCAGTCTACAGCAAGATGCAATGTCAGAACATGGCCATAGCAACAAGTACTAGTAA
AAGAAGTGCAAACTTACTTGTTCTGCGATAGGCGGAGCGCTCCACGAGCGCTGAATATCCATGCCGATGGACGCGGGGTTGAACTGCGTACCAGCGTTGG
ATTCTCCGGTCTGGCTGTCGTTCGCGAAGCCGTTGCGCTTAGATCCATCCAACAGAGGACAATTCATCTGCGTTTCCGGCTTCACTTCTTCACGAGGCAT
GCCGTAGGTCAGCGAAGACGAGCGGCCAATAACTGCGTGCGATGGAGGAGTTGAGCTTGATCGCTGGTAGAGTCTTGAATGTCGCTTGATTCCAGCCGTT
GACCACATCGATGAGGAAAAACTGTCTGGGAGGCACTTGGTTGGATCTTGCAGCTTCACTCGAGTCAACTCCACCGGATTGCCAAGATGAGCAGCCTTCT
CCTGACCGATCGAGCCATTTCTGCGTGGCTGCGGGACTGCTTCTCCTTTCTTGCCCCTTGAGGTCTTCATATCTGCTCGTCCAATCGAGTTCGAAGTCAG
TGATCAGCGCTCCGTTCTCCCACAGTGTACAGCACGTCAAGGTACCTTTTTGCGGTGCGATGATGTCTGATTGACGAAGAGCCGATTCTTGCGCTAGGAT
GAGGGTGGCCGATCTCGACGCCGATGTTCAAAGCCCGTTGGAGTCTGCATGTACAATCACGAGTGAGTCAAACGTCCATGAGAGTATCGCTGCCGCTACG
AGACGTGAAATTCTCCGACTGCCGACGTACCAATACACAGCGAAAGAGAGAGAGCAGTTGCTGCTGTTTCTTCTTCGCGCTCGCTCGCTCTTCTTCCGTT
GGATCAAGTGAAACGCCGCCACTGCGGTTGGCTGGTTGGCAGACGGCTGGGGTTAGCGAACGTGCGCGACCTTGAGTTCTTCGACAGTGGCTTCCGGTCG
CGGGTTGAGCGCGAGACTGCAGATTGAGAAATGAAATGGTTCAACCCGCACGCGCACCCCGCGCCGTTATTTGTGAGGCGGCGCGGTCAGTTGCAGTTGC
TCCTCTCGAGCCAGAGTGACTGCAACAGGCGAAATTTCTCAACTGCGTTTCAAGATCGAAAGGGGGAAAATTACCGTAATTTATGAGTTCGATTTGGACG
CGCGACTGGTTTTCATTGAATTATATTTTTCGAACATTACAGCGGTGTGGTGGACGAACGACATCAGTCAGTCAGCGCCAGGCATGGCCAATGCGCCTTG
CGTTGCTGCAATCATCCGCACCTCCCCCCCTCTCGCTCGATGGTGCTCAGCTGGATACCTTTTCGCTGGATGGATCGCACTCTCCGGATCTCTACGCCAT
CTGCAAGCTCAAAGCAGCAATGCCGCATCTTTTCATTCGGAAATCTATTTGAACGCATGTGAAAGATCTCGATTGGAGAGCAACTTTCTGATATTTCGCG
CGTTCATGTGATCGTTGGGGTAATGACTGTACCACAGTGAACGACTGCTGGTTGTTTGTTAGCACAGTTGGTGGCTGGAGTGGCACGCATGCTGCGAGCA
GCGGTGTCCCATCACTTCCCATGCAAACGACGTGATCAGAATGGACTCGTCAGCGAGAAAAGTGGCCTCGGCCTTTACATGACATGCAAGTCACCGTCAC
CTGTTGAAGCCAGCAAAACGCGTTGAACCAGTCAGTCGGGCGTTTGAAAAAAGAGAGCCGGCATGTGGATTGCATATCGTGACGACACACAATACGCAAC
AAAAGCTCTCCTTGGGCCCCTTCACTTTTTTCAAAAGCGTCCGTGGATTTCCGGTCTTCTGTTTTTTATTGTGTTTGTTTTTGTTTTGGGGTCGCCAGGT
TGAAGGCGCAACTCAGGTTGAAGCGAAATTGGCCATAAAACAATCATTTTGCTGAGCCGACCATCACTCTGGACGTGATTGAAGAGACACAGTTCCATTT
TTAGAGATGGTGGTCATCGTATTGCACCCTTCAGCAGCAAGGCCAGATCGCGTTAGCGTCCATCTGCTTATCATGTTGAAGAGCGCGGGGCTGCCTCTCC
CTTGGTTTCCCCTCTTGCAACCAGCTCTTCGAACAACTGCGACTCGCATTCAATCGCTTCTGTGGCCGCTGTTCAGATCTCTTCGTCTCTCTTCGTCGCC
AAGTGTTAAGCGTCTCTCTCTTTCTCTCGTTTCCTTGACGCAAGTCTTGCACGCATTCAAAAGTATCCTTTGAGGAGAGAGGGGACACGCCTGTGCAGCC
ATGTTGCGACCGTCTCCAGGCTGTAGACGTAAATTACATCACGAAGAGACAGGGGCAACTTCAACAAGCATCGTCAATCAATCAAGTGAGTTCAGCGTTT
CGTTCCCGCGAGCCAGTCGTGCAGCTGCACACGAATGAAGAGTAGCCACTTCGCTCTGCAATGGACGCGCATCGCCATCATCCGAGTGCAAAGAGCAAAG
GGCAACCGCACGTCACACAGGAAGAGGTTGTTCATTGAGGGAAAGGATCTACAAAAGTGCAACGTGAGCAGTTCTTCCTCCGTGCGTCTACAGGTTGCCC
TCTCTCTCCCACGCGCGTGCGTCTACGAGCGCTGTTGCTGCTTGAGAGTCAGCAGCGTAACCGCAGCAACGCCGGCAGTCACCAGAGAGACAGTCGCCAG
CGCTTGTCGTGAAAGATACCATGGCTCCTCCATGGCGGCCTTCTTCGCAGCCTCCTTCTCTCGCTGCGCCTTGGTCTTGCGCGTGAAGATGGACGACTCG
GATGCCGCGGAATCAGCAGCAGCGGTGGCTACAGAAGCCGGCGTGGTCGCCTTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTGGCGTGCCCTTCTGCGCATAAGCGGCCCTGGCTCCTTCCTCATGACCGCTTCCAAAGATGCCGC
CCCATCTCTCGCGCTCTTCGTTCTTTTGTTCGTTGATAAGCTTCGTCACGCGGTCCAACAGCGCGCGGCACGACTTGTCCTTGGGTGTGAGCTTCACGGC
GATGATCAGGTCCTGCTTTGCGTCGCTGTACTTGCCGAGCTTGAACGTCGCCTGTGCACGGCGGAAACGCGCTTTCGATGGCCACTCTTCGAACAACACC
TGGTCGCTGAGACCGATTCTGCCCATCCACGTGACAACGTTGCCATGGCGGTTTTCACCAAGCACCGTCAAGATGCTCAGCGCATTGGTGCACGCAACTT
CAGCATCGTAGTACGCGTCCAGCTTGAGCTTGCACGCGCCGATGTTTAGGTGGCAGCGGATCATGGTTTGGAGCATCGTCGCCTTCTCCTTGTGGGTGGC
ACCATCCTGATCGACACGCTGCAAGTAGCCGAGCGATCGCAGGTAGCTGTAGATAGCGTCTTCGAGACTGTTATTGCGGAACTGCTCGTTACCAGTGTCT
GCCAGCGCAATGGACTCGGCGATGAGATCTTTCGTCTTCATCTCTTCGATGGACTTCTCTGGGATCTTGACGTCCTTCTTCTGCATAAACAGACGGGCGT
ACTCGGTCTTGACGATCACCACTTCGTCGTGCGGACGAATCTCGTCAATCAAACCTTCGCCATACGGAGTCGAGACCTTCATGTGCATGCGCAGGTGGGG
CTCATTCGGCTCCTCGCGCACAGCCTCTTGACGCAGGTACGCGAGCGTCGGGTTCTTCGCAGCAGAGTCTGTGTCCAGCTGGACAACGTACATCTTCGTC
TCCTTGCGGAACGAGATGACAACACCGCGCCCGAATGGCGTCACGATGCGACTTTTGTCCGGCAGCGGGGTCACGCTCACTGCGCCTGGGTGGTGCGCGT
CCACTTGGAACTGGTTTCCTGGAATGTACAGACCGGCCTTGGCGGTAGCAGTGCCAAACGCAGCTGGGTGCTGAGCTTGCGCTTGGAGCACGGCCGCAGT
CTTTCGGAAGTGCTCGCTGCTCTCGTCGTTCTCCTTCTTCCTTAGCTCCAACGCGGCGATCTTGCGCTCGTGCAGCTCCACAGAGTTGTACTCAAACGTG
ATTCGCACCAGCACTTTGCCTTCAGCAGTCGATGAGAGAGCGTGCGCAGACACTGGGGTCTTGAGGCTGATCCACTTCTCGTGTGTGTGCTGGTCCAAGA
AGTCGCTGCTGCTGATCTCCACTTCTCCCAGTACGATGTCGGCGATGATGCCAACGCTGCTTTGCACGCAGAGCTTGATCGAG