Description :
From Genome Similarity Track
Location :
Scaffold_1203:512- 4563
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1203-snap-gene-0.3Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1203-snap-gene-0.4Cyst wall protein

Sequence
4051 bases(100 bases per row)
CATCGTGCGGTTCTACCTGAAGGCGCTCACGTGGCACGGCACGCCCAAGACGCTCTCGTCCACGTCGCCCGTGACTGTAGCAGCCAAGCTCAATGGAGAG
CAAAATGGTCCAGTGGGCAACGAGTCCCCGTCATCTACTCCTCACCAGAAGAACGACTCGCCCAGTTTCAACAAGAGTCCGGATAAGCAACCGGTTTCTT
CGGCCAAGCCGTTCCTACTGGACCTCGCTGGGAGCTTTCGTAGCTCGTCATTATCACGACTGGGTTTGGGACGAGGCAGCAGCACCAGTAGCAGCAGATA
CTCGGACCAGAGCGAGGCGAGTGCAGCCGTGCGCGGGTACATTCTGCACATTGAGGAGCTCACGCTCATCGAATGGAAGCGCATCTTCTCAGGCATGTAC
CGTTTCCTCTGGGGCCCACCAGTTTCCGAGATGATCAGGTCTGGAGCACGCAAGGCAGATGCTGATGATCACGAGGCGGAAATTGACAGCGTCCTGCTGG
CCAACATGTGCAGAATCACCAAAAATTTCGCGGTGTACCCGTCAGTACACGCGATATTCTCGAGCATCGAGGTCCCAGGCGGCGAGACGCTCTTCGCACG
ATTTGCGCACCATGCGTACAATCTGGAGGTATCATCGCTGCTCCATGGGCTGGTTCACCTGGCGCAGAGGCGGCAGTATCCGTTCCAGCCAATCCTCGAG
AGCCTCGTGCAGCAGATCATCGACGTCCCGCTCGAGTCCCAAGGGTCGTCAACTTCATCATCATCATCGTCGGCTTCTCAGTTCAACTTTCGGAATCCGC
TCCTCCATGCACGTGTCAGTGGCTGCACTGACATTCTCGTGAAAATCCTGATGCAGCAGTTCCCCAACACGTTTTGCTACTACATCCAGACGAAGCTTCA
GCTGGCGTCCTACGAGAGCGTCGAGTCATTTGAGCGAGAGATCTTCCCGCCGAAAGTTCTCCCAGATGACCGGATATTGCACGAGCGGATCAAAGATGGC
GTGATGCAGGCGCTGCTCGAGAAACCGGAAATTGTGACGCGGTTCGCGGAAGTCGGTGTCGCCGAGATCCGGTACCTGGATGCGAATTATGCCAACGGAG
CTGGCATCCCGACTGCGTTGGTGATCGATGTCATTAAGTGCGCGATCGAGTACTCGTTATTCGACAAAGCCCGAATGAGTCTGTTTGTACCGCCGGTTGA
GCTTGTGGTGGAGACGCTCTGTGCTGCGATCAACTATCACCAGCACATTTCGACAATCACGGAGTTTGCCTCGCGTGATTGCTTTAGTGACAGTGACTCA
GAAGATTCCCAGCACAGTGATGAAGAGGACTCGACCGACGATGTATCGAAAAGAGACGAGCTTCAAAACCAGTCGGCGGTGCCACCGCGTGTTCTCCCGA
TGGCTACATCGCCTACACCACCGGTACCACCAGAGATAGCGAGGCGGCAGCTGCAGCGCAGCTTCATCGAGCCGCCTGCTACGTGCATATCGCCGTCGTC
TGGCAAGCGTGTGATCAACCATCGTCCGCTGGCATCCATTCTCCTCGTCGTCCACATTGTCGAGTTCATGGACGCAGTCATCCACATGGGCAAGGACTCT
ATTGATAAGCATCTGGCCAAGTTCGATCTCGCGACGTCGTTGATCGACATTTTCCAGAAGTTCCCGAAAGCGAATGTGCTTCACTGCCGAATCGTCAAGC
TATATCTGAACCTATTTGACCGCGTGGCGTCCAATGGTCGCGTGAACAACCCACTGCTGCGTAGTGTGTTCCGTCCGCCAGAGTCGCTTCTCGGGTTCAT
CTTGCAGAAACTACACCAGAGTTCATCGACCCATCCCTACGACGCGCATCTGGCGATTCTCGGTGTCAAGATCCACAAGATCTGCAGCTCGCCACGGCTA
GAGCAAGAGCTGATTCGCCAGTATTGCGAGCGTTTTACTGGCTGGACCGAGTTCAGTTCGTCGCTGGTCGCGTCTCACTACCAACAGATCGACGCGCTCG
ACGACGCTCTGCTTGGTCTCAGTGCACTCAAGAATAGCGGCGCTGGTCTCCACAAAGCCCGCGGCAGGAGAGGAAGCGATGGCATGGATGATGTGTTCCC
CCTTGAGAGGCCTTCGTCATCGGCGACCAGCTTTCTGTCGCAGGAGTTAGAACCGTTCCGCCGGTTGCCAATGGAGAAAGAAGGATTCGGCTCTTCTCAT
AACATCGCTATGGGGAACGAGATCGTCAGGCCGACAGATATGTTCAAGAGCCGCTCTCTAAGCCAGTACCCGCAGTCGATCATCGAAGTCTTGAAAGCTG
ACACGGGAACCTCGTTTGACGCCGTTGAAGACGATGTCAGCATCTCCGGGTTCGTGTACCAGAAGAGGTCCAAGTGGGTCAAAGTTTACCTTCGGTTTGA
AAAGGAAAGCTGTCTGCTCACCGTTGAGGATGCCCCCGCTGCTGCTGCGACGAGCCAAGGGAAGGCGGCAGGCTCTCCGGTGAAACCCAACTCCACAAGT
AAACTGAAGCAGTTCCTGATGTCAAAGACCCAGCACTGGACGTTGCGGTCGCGAAAGTTTGTCGTGTGCAACGCCCGGAAGTGGATCGCGTTCGGCAGAA
GTGTCAAGAACCCAGGCATCGGTGCATTTGGGTTCCAGGTTGAGGGCTTTGATCGCAGTCGCGAGGTGGACACGACGCTCACGTTTGTGACGAGGTCGGA
TGCCATGCGCGCAATGTGGTATGAAGGGATGCAGCAGGCCATGACTGCGTCGCAGACCATGCGTAACAGTATCACTGAGGAAGACGACGAAGGCAACATC
ATGCTGGTCAAGTGCGTGGCGACGAAACGAGAAGGGCAGGAGATGCTGTACCATGTGGTCCCGAATGTCCATCTGCTTGGACCAGTCGTGGCGCCGACGT
TCTTCATCAAGTCGGAAGTTCCCGAAGAGCTGCCGTTCTGGGGCACATTCCATGGCATGCATGGGATTAACCAGTACGTGTCGCTGTTGAATCGGTGCGT
TCGAGTGCTGTCGGTGAATGAGAAGCGCATGTACGCCAGCGGGTATTCCGTCATCGTCGATTTTGATGCGACGTTCCAGCGTGTTGAGTCTGCTGACGCG
GAGCGAAAGATGCCGATTCCAAATGGTCACGGAACTCAACCGAACGGCTCAACGGCAGCAGCAGACTCCAACTCTGTCACGTGCTGCTGCACAGACACGT
ATCTGATCACTGGCAATCAGATCATCTGTCTCACACGCACAATCGCCGATTCCGAGAAACTCATGGAGATTCTGAGCGATTACGAGTGAGAGTGCTCTGG
CATCATTACAAGGGTAGAAGAGAAGGTCTCAAATGTACGACCGAGTCAGCCAGGCGATGATTTCACTACGACTCAACTCGCCGTCACCGCTCGTGTCAAG
CTCGCTGAAGACGTGGTCGATCTGCTTATTGGACATGGCCATCCCGAGCTCCCCGCAGAGCAGCGCGAACTCGTCTTTGCTGATCTCGCCTGTGCTGTCT
TTGTCGATGTCTCGAAAGAAGAGCTCGAAGCGTTCGTCGTCAGTTTTGTCGGCGCCGTAGCGCGCTTTCAGTTCCTGGTAGATGCGACTGAGGAACACTG
GCGGCTCCCAGGTCGACTCGCCCGTGACGCTGTTCCAGTAATACTACACACACACAAAGAAGTATCAAGACGCGCGCAGCACGATTGTCGTCAGCCTGCT
AGAGGGGAAAAAGGTGAGAAGAATGACGAATGGAGCTAATAGACTTGCCGTGTTCCCGTAGCCATCGTCGTACGGCTGCCACGCGTCTGCAATGCTCGGT
GAGTTGTGGTTATCGTCATTGTTGCTGTCAGATAGCTCCTGTTGCTGCTGGTGGTGGGGCGTTGCGATAAACGACGGTGCTTCCCAGGTCGCCTCGCCCG
TGCGTGCATCGACAAAGTACTCGAGACCTGTCTCCGAATCAAAGCTGCGCTGAAAGAGCGACTTGAGGTACGTCCGGAACTTTGTGCGCTCGATCCTCGC
ACGGTAGATGCGTTGCAGCTTGATCGCGGCGGCGCTGCGCTCGGGACCCGT