Description :
From Genome Similarity Track
Location :
Scaffold_311:512- 3459
Sequence
2947 bases(100 bases per row)
AAGCAAAAATATGAAATGCCTTGATAATAGTACTAATCAAAATAATATTGTAAGTTAAATTAGTACAACAGTGCTACGAAGCCTAAAACATCATTCTATA
TTCAATAAGTACTAAAGTTTCGATTGATGCCGAAATATAAGTCACCAAAGCCTACCCTTTTTGTCAGCATCTCCTACGACGATATAGTACGTGTGTGCTT
ATCGGCGCCTTTTAATTATGCTAACTAACGCGTACACAGGCAGCGCCCTTTGCGTGGCCTTGCATACCGACGCTGAAAATGAGAGCAAAATGAAATTTAA
GCAGTGCTTTTAAGTACGATGTGTAGACCACATATAATATGTAAGAAACACAATTTTGTTTTTTGTAAATGGGGGCCGCCTTCGCTGCGCTCGACAGCTT
TTTAGCGAATCGACGCCGCCTTCGCTGCGCTCGGCAGCCAGTAGAACGCGCGTATTTGCGTTACATTAATTAACCCTAGCCCGTTACGGACGGACTGACA
GACAGACACCAGACTCCAGTAGGGGGGTAAGACTAGCCGTTCGCCGCCGCTACGCGGCGGAGTGGCATGGTTTGTTGGAGATGAGGTGGCCGCAAATTTA
AGTGCTTCTTGGTGTCGCGTGTTTTGAGAGCGTGGTTCACCCCGTAGATCTTGGCATCGTGTATTTAACCACTTGCCTTTCCGTAGTCTCATTCGGCCCC
GTATAATATCGTGGTTTGGAACGCTTCCGTTACCCCGTACTACAGGTTAGATCTCTTGTTCTACAGTGGCCGGCGCTCTTCCGTGATCTTCCTGGCTTCG
TGGTTCCCTGCTCACCCGTGGCACACGCTGCTTAGTAGTTAAGAGCTCTCTCTTTTGGGTTCATGTTTTTTTAGTACTGCGTCGTGGCTGCTAACTATTT
CCTGCTCTCAAACGTTTTGTGGGCTGCACCGGCTTTCTGAGACTCAGTCTTTCGTGACCGTTCGCCTCCCATAGCTGGTACTCTAGCCGAAGGGTGCTTT
TCCGTGGTTTGAAGCCTCCACGCAGTCGTGTTGTTCCAGCACCCGTGTATCGGGCTCGTTTGGTGAGGCTCCATCGACCGCGTTATAACGCCATCGTGTA
ATTGCGATATGGTTTTGCTGTCTATGGTATTGTGCTCGCGGATTGCATCTACTAGATGAGAATCCACCCAAGCCCATCAATTTGAGCAAGAGGTGCGGCG
GGCTGGGCGACCGAAAACAACTGCAGCGCAAAACTCCAAGAAACGAGCCACAGCGCGTAAGAAATTCAATACACGACTGGAGAAAGGCGGAGCGCTATCA
TTCGAGGACGTCGGGGTTGTTGCGCGCATCCTTGGCGACATAAACATCAGTTTTACTAATATTTCCGAATTGCTGGATGTTTATCCAGTACAGTATGAGA
GTGCTGCCCGTAAGCATCCAAAAGTTGGTGGAGATAAGAAGCCGATTCTGAGTGCTGCTCTACCGTTCCTACTGCCTGCTCCATTAGTGAAGAAATCCTT
AGATGTAATCTACGAGTCTGGCGCAGTTCCGTTGCCAAGCCAAACCGATGAAGAACCCCTATACGTCAAGATTACCGGTATTGGCAATTTTTCGCTGTAT
CAAGTCGACTGCATGCAGAGAGTATGGACAATGAAAGAGGCTGTTGTGATGGGCAAGAGACTAGTGGAGTGGTTGAAGTGTGTACGCGTCTGAAAGAAAC
AAGCAGAAGAAGTTCTTAAGCGCGTTCTACAAGCGCATCCATTTGAAATCGTGGAGGGTAATATCGGTGATTTGGATTACTCAACGCTGTACAGACTCCA
ACCGAAGGACTGGATAAGCTCAAAGATATTTGAAGCAATGGGAGAGATTTGGAAAAGAAATCATAGCGTGACCGTGGTTACAACTGCAGGGTTTAAGCTC
AACAGAAAGGTCAAGGGGGTCGACGTGCCGGCTGGTCTGTTGAACAAACTTACGTCTATCACTTCCAGATTGGTGTTTATACCTGTTAACTTTGCGCAAG
TGCATTGGCACTATGATTATTGTCAACACGACGACGAAGAGCATTTTTGTCTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTCGGAAGATCACCCATTGGCGAGGGTACCACGATTACGGAACGCTATCGACCACGAATGATTATGGACACGAAGCCTGTGGAATCCACGTAAA
CCCTTGAGAACACGGAATATCTAGCAGCCACGAAAGAGGGTCGTACTACGGGAGCGCATGAGACCAAAAAGGCTAGCACACAACCACTAAGCACTGTGAG
AGAAGGAGTCCACAAACACAGGACAATCACTAAGCAGCGTGGGCCACGGGTGAGCAGAGAACCACGAAACCAGGAAGATCACGAAAAAGCGCCGGCCACT
GTAGAACATGACATCCAACCTGTAGTACGGGGTAACGGAAGCGTACC