Description :
From Genome Similarity Track
Location :
Scaffold_1539:512- 2953
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_1539-abinit-gene-0.1Gene of unknown function

Sequence
2441 bases(100 bases per row)
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNtgttggccagcAGTCTCTGgtagatctggggagcattCTTAAGCCCgAAGGGCAtCCTTAGCC
ACTCGAACAGCCAAACGGCGTGATGAATGCAGAGATTGCACGCGCTCTTGTTGTCATCCTGACAACCCAGAACCCGCTTGCCATGTCGAGTGAGCAAAGC
CACTGCAGTGAACCGAGGTCCTCGAGTAGATCTTGCACTACCGGCATAGGATAGATCATCAGTCTTGTCAGTGAGTTCACCACTCGATAGTCGATACAGA
GACGGATATCCACGCCGTTCTTCTTGATCACGATCACGATGGGGGAAGCCCACGGTGACTGAGATGGCTGGATGAACTGAGATTGTAGCAATTCTTtCAG
GAGCTTGTAGAGCTGCTCACTGAACTGTGGAGGCACCTTCCTGCACGTTTGTGCGATCGGCTTGGCATCTCCCACGTCAATATCTTAGATAACTCCCATG
GCCGCCGGCGGgCGGgCATTACCCTTCCCCACCAGAAACGCtcTTTTCTTCCAGACGATGTCTTTGACTCGCTCGATCATCTCGGGGGTAGATCTTCGCC
AACCGCTACCTGGATGTCTTCACGGCGGATCTCGTCACTGGGGTTTACCTCTGGAATGATGGCCACCTGTCCGTCGAGATCTTCAGCTGTAACGTCGCCT
CCCTCGTTGACGAACACTGCGTCGTGCAaCCGGGAATCCTCGACGATCACCTCCGCGATCGACTTCGCCATCACGAACGCGATGGCTGCTCGTGCCCAAT
ACGCCTTGTCGTCGCTTGGTGCCTCGGGCTCGCCAAGTATCACCTCCTCGTCGCCCAGATCACCGGAGACGCCCCTGGCCGATCGACTTAGGATTGCCTT
GGGAGTTGGATACTCACGCTTCTCCACTATCGGAGGTTTGTCTGCGGCCATAGCGGCAGCCAGTGCTCGTCGTCGATCTTCTAGAGCTGGCTCAGGTTCG
ACTTCATAGACAAGTGTACACCACTCGTGGTACCGTCGTGAGCCGACCGAGACACATCTAGTTAGACGAGCAACTGCCTCGTAAACCGAGCCACATTCCC
ACGACtGTCTGGGCCGATATGAAGGTAGTTTGGCTCGATACGTTGGTGATCCTCACTTGGATCGGCTTCCCTTGAGCATTAAGCTCCACCGTTGGCACCC
ATGTATCCCCTCGTCGGAGCCACAGCTTCTTCCGGTTCGGTGACTTGACCCGTAGATAGATAGAGCTTCCCACCGTGAGGGTAGTATCGCCTTTcACCCG
GATCTGCTCGGCCTTCTCACTGTGCaGGGGCTTCCGGCCCTCGAAACGTACCCTGATCTCGTCAGGCATTAGAGCGACACCTTCAGAGAGGTCGAGGCGG
ATCCCGGCTGGAGTCAAGAAGTCACAGCCGAGgaTTGCGTCCACGTTACCGAGTTTACCGACCCATACTTGGCACTCATAGGCTAGTtCATGGGCAAGTG
TCACCTTGACCCACGCCTTCCCTTCAGTGGTGAATGCCGACCCTCCAACACCTTCACAGCCTAGCTGCTCTGATCGGTCGACCTTAATGCCCTTCTTGCA
CGCAAAGTTGGCATCCAGGATCGAGACCTCTGCTCCTGAGTCCAGTAAGACTCTAGCGTTGTGATCATCCACCTGGGCAGCGACgATCGTCTGGCGACAC
AGCTTCTGAGAGTAGTATCTCCAATATCCCCGTcGCTCTCC