Description :
From Genome Similarity Track
Location :
scaffold_1732:512- 2458
Transcript NameFunction/comments
Pl_100384pol protein

Sequence
1946 bases(100 bases per row)
CCAAGTTTTGGAAGTGAAACCAGAGTCGTTGAAATGACAACTGTCAACTTTTGTTGACAACAGGCTGACGCTTATCAGCCGGGTCAGAGATGCAATGACA
TCAGCCCAAGACAAGCAAAACGAATACTCTGACACAAAAGGTAGAGAAAACTTAAACGTATATGACGTTGGGGAGTTAGTCCTACTAGACACTACGAATC
TATCTCTAAAGCTGGTTAGCTCCGTAGGGAGTAACAAGCGGAAGCATCGCTTCATTGGACCCTTCGTGGTCCTAGGCAGGCATGGGGCCGCCTACACGAT
AGACTTACCAAAATCTATGGCGACCCACCCAACGTTCTACGTGAGCAGGCTCAAGCAGTATCATGATCCGCTGGGCCCTTCTCCTCAACAGGAGGCAGAG
GCCGTCCGTGAGGAGTTGAGCTCACCTCTTCAAACCGAGGTGGGGCAACCGGCACTGGAATTGCCGAAGCCGGTATGGGGAAAGGAGACTGATATCCCCG
CGGATCGTACGCCGAGTACGCAGGGTTCCCATGCAAAGGACCCCCATAGGAGCCATACGCATAGGTTGGGTGATACCCTTTCTCGGGAGGGTGGCCAGCT
ATGGACCTCCTGACTCAATTAGTCGAGGTCACGACGCAAGTCCTGTATGGCAGAAGACGGACCTCGACGATCAACGCAACCATGAAGCTCCCGCGTCGCG
CGTCAAGCCCTCCACATTGTGGCAAAGGGGCTCAAGCGTACCCGGCTTCCCCGCCTGGGAAGTAGCCTGACCACCAGGGCCAATGCCCAAGGCAATCTCA
ATCACGTATACGCGATTGCGAAGTTGCCGGAGTTCCTCCTGTCAATAGGACTCACCAGAGTCCCGGTCCGAAGTCGAAGGTCATGGGGACTGGGGATGAG
GAACCTGTACTCGTACGCGTGCGAGAGTTCCACCTGCCCTCCTGGACCGGAACGGTGAGTTCCACTTCCATGTGGAACGGATTGTCCAGGAGCGCCGGCG
CTCTAGGAAACGCCAGCTGCTTGTGAAGTTGCGGTGATACCCGCCATCACAGAACTCGTGGGATCCGGAAGACCGGCTCCAGGCAGACTGCCCAAAGGCT
GTTGCGATCTCGGACCAGAAGCAACAGCAGCTTCGTAAGTAGTCAGTGGCTTCTTAGCGGATTTACGGGGTACGGTATTAGAGTACATGACGTACCCGCG
CTCATCTGGAGCGCTAGACTAAGCGGCTTGCTTAAGTCTATCCATTGTGGAATGGAGTTAGCGCTTACCGATGAGGTGCGCGAACTCAATGCGAAGAACG
CGCTGGTCCAATATGTGGGACAGCATGCGGTCTTCACGGAGTTCATTCATCTCCTGAGCTGAGTAGTTCTGCATAGAGACCCAGCTCCAGAACAGGTTCT
CAGTCTCTGTAGGAGTTGTGGTGTTCTCGAGCTGCACCCAAGGGTAGCCCCACACCGGAAAGAATCCACCACGATCCTCCGGCTTCTTGCGGATGCTGGT
GAACTCCTTCAGAGGAATTTGGTGTGCTGTCAGCAGCACACATCGAACCACCTCAATATTATCAATGAAGAGTGGCTCCTTTTGAACGAGTGCTCGTTCA
TAGCCCCCCGAGACGTGCGGCCGTGAATTAGACCATGAGGAGCTTGAAGCTTCTCCAGAAACAAAGGAGAACTCGAGCCCGCGTCGGGCGGGTAATACCC
CTTAGGGTACGAAGGTGTACTAGGGGTTGAGCGCGCAACCTCAACGGGAGCTTGCGCCTGAACAACATAGAATCATTCTTGCTGCTCATCGAGCTCATTG
GTGATCTCATGGGGCTCGTGCACAGCCCCTTCCTCGTCGGAGTCAGAGCTTGCATCGAACAAGCTCCGATATCCTTTGCTCTCCGCCGAATATCGACGAA
GAGAGCTAGAAGTCGCACGCTTCTTAGCTGCACCGGCTTCTTCAAC