Description :
From Genome Similarity Track
Location :
Scaffold_1834:512- 1709
Transcript NameFunction/comments
Hyaar_Emoy2814830U3 small nucleolar RNA-associated protein, putative

Sequence
1197 bases(100 bases per row)
GTCGATGATAAAGGTGCATGCGGGACTGATAAGGGAGATGACGGAATGGAATTGCAGCGACGTGAAGAGCAAGAGAGGCACGATGAGCGACTCAAGTCTC
GCGCGCCAATGGGCTGGTTGCTTACTCGACTCTCGTATATAGCTCGTGGCTCGAGCTGCAGCAACGAGGTTCAAGTTGTGGTTTATAAGCTGTTTGCCGC
ACTCTTGCACAGTCACGACGCTGCTTTTGCTGAAATGTACGTTATGCAGATGATCAACCCGCTGTTTCGTGCGACGAGGAGGCTGGACGAGCTCCAGATC
CAACGAGAGCAAGAGGCACTTCACCTACAGCGGCGGTTTCGCCACGAAGCTCGGACAAGTGGTGCCTCGCTGGCATCTGTGACTCCGCCGGCAAGTGCAC
TGCTGGCCCAAGAAGTGCTGCAGATTCTGGAGCAAAAGCTGGGCGCTACGCCGTATTTAGAGGCATACTCTTTCGTGCAGAGGAAAATGGCAGCACTCCG
TATTGCACGCAAGCAGCAGCGTCAAGCCGAAGCTATCTCCGATCCTTGTCTGGCTGCTCAGCGGCGGATACAAAAGAATGAGCAGAAACGCCGGACAAAA
CAACTGCGCAAGCGCAAGTACGCGGTGCTGAAAGGCTCGACCTCAGCGGCAGTGCGTCCGACAAAAGTGCTTCGTCCTGGTGCCGAGTAGAATTCGTCAT
TCGCTGCTGGCAAGGAAGGGTATAGACCATAGCTTTGATACCTTGTATGGATAAATAACATTAAATTTCTGACTGGTTTTGAATTACGTATTGATTGCAT
TGACCATGAGGGTGGGCGTGGTGATTTAAGGACATACATTAGCGAGTCAAATCGGACAAATGCAATCTATATAACCAATCAAGGAGTAGATGGACAAGTG
AAGCTCTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGTTATTGATACCACCCTAAAACCACCAAGTCACTCGCATTTTGTACAGATTACA
CCTAAGCTCTGACGTCTCCGACGAACGATAAGTCTGATTAACCTAGACAGCAGTTGTGCAAAGTGCAGCGACAGCGCAAAGGGTACGGATAGGTGAACCA
AAGGTCATTCAGGAGATATCTTCCTTCTTCGTTGTGCAGATGAAGGGGTGGGCTAATAAAACGACTTTGTCGTGCTTGTTTGTCTTGCCATCAACCT