Description :
From Genome Similarity Track
Location :
Scaffold_24:5119- 6739
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009102Similar to Ank1: Ankyrin-1 (Mus musculus)

Sequence
1620 bases(100 bases per row)
ATCGGCAATATCGGCCTGCCCTTGTCTTCGGCGAACGCCAGCTGGTCCTTCAACGTCTCGCTCGACACAGTCTTGCTCGAGATCACAACGACGAACGTTG
AGCACTTCGCAATCGCCTCCTTTGCGGCGTAGATGCGATCTGCCATGTTGTCGTACGACTGCGCGCCGTCCAACACGCAATCAATCCCATTCTCTGTGAG
TCGGTCGCAGACTCGTTGCGCGAAGCTCGGGTGTTTCTCGCCATGTGAGATGAACACGAAGTTGCCGCCAAGGCTTGCCAGATCCCATTCCACGCTCGTG
ACGTTATAGGCCATGCTCAACTGGGTGCGGCCCAGTGGACCTCGTCGTCGTTGTCCTCTTTTCGCCACATTCTGTTTGCGCTGCTTCTCGATTTCATCAC
GAACCCCATCAAGCAAGAGGCGGAACTGAGACGCATACTGATCCTCGATGTAAGTGTAGGTGATATTACGCGGATCCGAATTGCTCACGCTCGTGATCGC
AGGCTCGAACGGCACCATCTGGCGCGTGTACAGGTACACCTGGAGGTCCTCCGTCACGGCGACGTGCTCCGTCGAGATCGCCATGATGGGCGTGCCCGTC
TCTTTCGCATACGCCAGCTCCTTCAGACACCACTCCGACCGCGTGTAGTCTTCCGTGAGGATGCACACGACCATGGCGGCATTCTTGATGCCGCGCGCGA
TCTCTTCGCGCCACACGGAGCCACCGCCGATGCCGCTTGGATCCACTGTAAAAATCAAGCACAGATGCAGACACACAGCAAGTGATGTTGTGGATTAAAT
AAGTGCGCATCACATACATATAAGCAACTTCACCAAGGATTCAAGCAAACACGTACTCAGATCCAGCCACGTCGTAATGTTCGCTTGTTCCAGACTCTCG
CGAAGCTTCAGCGCAAACTCGCTGTGCGAGTGCGTGTAGCTGATCATCACGTCGCGGTTCCCAGCAGCGCGCTTGATCTCAAACTGCAGCGTCGTGGACG
TCGTGCAGTCCACTGGACGGTAGTCGTCGTGATTGGTTCGCATGATGTCGCCACCGGCTGCCAGCAGCGCCAGCGCCGTGCTCTGGAGTTCGTCTTTCAT
CGCCAGATGCAGTCCCGTGTCTCCATTCGGGAGATGTTCATTGATGTTGGCGCCATACTGCACCAGACAGTCGAAGAGCGACTCCGACGCGGTTTTTGCC
GTTGCCGCACACAGCAGCGGGGTCATGTCTGCATCGTCACGAAGGTGCGGATCCGCGCCTTTCTCCAAAAGCATCTTGACCACATCCACGCGGTTCAAGC
GAGCCGCCCAATGCAATGGAGATCGTCCCTGGCTGTCCTGGAAGTTCGGATCCGCACAAGCTTCAAGCAGTACATCGACGGTATCGACAGCGCCATTGAT
AGCAGCCCAGTGGAGCGGCGTCCGACGGTACAAGCCACAGTAGCCGTGCTCACCTAGGCAGTTTGGGTCGGCGCCTTTCCTCAGCAATTTGCGCATAGCT
GTCACGTCGTTCGCACCCGCTACTTCGTGGAGAGGCGTGAGTGCGACGTCGCCACCCCACTTTTCAATTTCTCGAGCCACGGGGATATTGCCGCGCAGAT
ACGCGAGTTGCAGCACTGTC