Description :
From Genome Similarity Track
Location :
contig_39:511807- 513548
Transcript NameFunction/comments
g7015.t1hypothetical protein PHYSODRAFT_552160

Sequence
1741 bases(100 bases per row)
TGCCTCCAACCAAGCGCCAATCGCTCCCAGCTTGCCGACTTTGCCGCGTCAATGAGTTTCCACCACTTGCTGTTGAATTCTTGCTGGACGATGGCCACAG
TCCAGACGCCAAGAGTCAACGCTTCGTACTGCAGGCAGCGACTACGTTCGCTGTGACCAGCACCGCCCGAATGCACCGCAATGATCGACTTCATTCACCC
TTCCGAACTCAGTAGTGACGTTGACGTCGTGGTTCTTGGCACAGTCTTCTTCCGAGCGTATTACGCGCGCTTCGACTACACCCACAAGCAGGTGGGGCTC
GCGTGCACCGTAGACGATAACGGCGTATGTCCTGGTGGTGTCCAGCCGGCATTAGACTATCGTGGCCGACCGTACGAGTCATTCGAAGACAGGAGACAGT
CAAGTCCAAGTTTTGTCGGACTCTGCGCTGCAGCTACCGCGCTCGCCTTGCTCGCCGGTCTTCAGATGGTGCTGTAGCTCTCCACAAAACCTACACTGTC
CCATTGAGCAGCAAAAAACGACACTCAGTTCACAAAGATATTCGTTAGTATATGTATTTCTCCACGCGGCAACTCACTTCAAACGTGCACTCGCTCCAGA
CCACCAGCTAGCCTAGCGAGGTTCCGCTTGCTGTGGCTCCGGTGGGCGCAACGTTGGCCGTGGGGGCATCCTTCACCCAGATTCGCAAGGTATCCAGCTC
GTCTGGAGCTCCTTCTCCACGCATAGCAGGAGTCCCAGGACCGAGAGTTCCGTGTTGAGCACCTGCAGACGGCTCCCACTCCGTTTTGAGCTCGATGTCC
GGCCGATAGCGCGTCAGAAGCTCGCGCAGTAGCCGCGCGAACTCGCTGCGGACAGTCGGGGGATATGGGCGATCTCCAGCGCCCGTGCACGCAAATCCGT
CGTGCGGCCGCACTGCAGCAGGTCAGCGATCCACGTGAGGCAGAAGCTAAACTTCTTCAGATTGGCCTTGCAGATACCGACGCGCAGCAGATGCAGCAGC
TCCGTCTCGCTCGCAAGGCGTGGGCACTTCCGCACGACGATAGCCTCGACACGCGCAAACAAGGCGTCCTCGTGCTCCTTGCCGTGCAAGCCTTGGCCAT
AGCACTTGTCGCACAGCTCGTACTCTTCACCTGCCAGTAGACGGCACGTCCGACACACCCACTTGACGCCTGAGAGCGGCCCGCGTCCACAGCCATCGCA
AATCGATTCATCCTCGTCGCCAGCAGCATCGGAGCCAGCCGTCAATGGCACAGGCGACGCATGCGACGAGGAGCTTGTTGTCGAGTTGGACCCCATCGAT
TGCAGGGACTTGTGCCGACTCAGTCGGTCAAAGACGCTTCCCACGATCTTCTTGATCTTGCCGTCCTTGCCCTCTTTCTCGCGTGGAGGCATCGGTATGA
CCTCGCCATCCGAACCCAAAGGGAGCACCCCCATCGACGACGGAGACTGCGCTGGAGACGGCAATGCGCCCATAGTCATTGTATGTGTGCGGGTCGTCTC
CACTGCGAAGGTCGGGCCTGTGCGCTTGGGGGTCAGCGTGTAGCGACGCGAGGCCTTGTCCTGCGCCTTGTCCCCGAGTTTATCCAGCGGCGGGATGACT
GCCCGCGCCGCAGTGGAGCCGCTGTGAGGGCGAGAGACGAACATGGCCTTGGTCGCGTGCAGCTCGCGTGGTCCATGGGGCACGGAACTTCGTCCAGCTC
CACGTCGATCCAGCTCCACCCAGTCGAACAAGTGCGGGGCC