Description :
From Genome Similarity Track
Location :
Scaffold_73:51173- 56567
Sequence
5394 bases(100 bases per row)
CCCCTTACACCTGGTAGCACCTTGTAGTCCGTCCAAGGACAGCAAAACCCGTTCAACATAAACATGTAGGACGACGTAGGCGACGACACCTTTCACGGAA
CCCGTGAAAGTTACACCTATTGAGCGATGTCGAATGGAGTGCGGTCGAACGAATGATACTGTTGACGAAGAAGCTGTTTGGTCTCTGCTATCCTCAAGGG
ATAGGGACTAACAGCATTTCATAATCGCCAAGTTCTTGCAGCGAGAACTTGACATGTCGCGAGCTGAAGTGACCCTGCTGCATAAGCGCGGTCGCCAGCA
GACTAATCTCCTGAGACAGCAACAGTTTCAGTCTGCTACTGCAGCGTCGACACGTGAGCGTCGACGCGAGACTCTAAAGTTAGAAGTCTCCAAGTACCGG
CGAGTCGAAGAAGACTCCCTGTTGATATATACCTGTAAGTAGACGATGCCATTAAGGCTCGCCATATCGACAAGGAGGAAATGCAGGTTACATTTGCCAA
ATCGAATTTGTCAGGGCGTGCCAGAACTTGGGCCCTGAAACTATCCAAACGTGTTTGAATCGTTGGCGGATTTTAAGGTTATGCTCAGACAAACGTTTGA
GCCGCCAAGAGCTGAGTTCAGGACTCTTACAGATCTCCTGAAGATAAAACAAGGTAAGCGTGACGTTGACGCTTACGCTCAGCACATTCGTTACCTTGCA
AGTTGCATGGTGGCGAATCCTGGAAGTGAATTTGTTGATCACGATATTCTTACAGGGCCTCATAGATGGTCCCATGAGGAACCACCTATTCCGCATCGAG
TTGAAGTCGCTTGAGGAAGCGATCACAACTGCTGTGCAAGAGGACTTTAGTGTGAGACAGGCTCACACTAGCTTGACCTCGTATCTTCCTTCGAGACGAG
TAGAGGCGGGAGGTCCGGAACCAATGGACCTCTGCAGTGTTGAGAGCAAGATACCTTGTTCTTCAAGCAGTAAGCGATCGCAAAAGTGCAATCGCTGTCA
GAAGTTAGGACACTACGCCTACGAGTGTAATGCTTCACGCCCAGTGTCTCGAAACACTGAGCAAAGTGATCGACCGTCTGCCAAGGAGGGCAACGGACGC
GGGTCCGACGCTGTTGCGAAGTCACAACAGCGTAGCGGACCGTAAAAAAACGGTCGGGGTCATAAGGGGAAGAGCACTCTACTGATCCAGCAACCTCAAT
AGAATTTTCGAACCTATTGATGAAAGCTGCTCCAAACTCACAATCCTCGTGTGTCTCTGCACTTGGTGATGGGGTACCCCTCATCACCTTGAATTTAGAA
GTGACAAAAAATTGTCACTTCGTGTCTTAGTTGACTGTGGGCGTCGAACAACTTTGTTCTTCGCCAGTCCCTAGAGGATCGTAGGCTCAAGTTTGTTGAG
CGCGTTACTCCTCCTACGAGGCTGACGGTGCGCCTCGCAACAGCCGCATCTATAGCAGTGATGAAACGTCTTGTGAGATTTCACTTCACGTTAGAAGATT
TACAGTACAATGATGATTTCACAGTACTTGATTTGGATGACAAATTTGATGTCATCCTAGGGTTACCCTGGCTTAGAAGGTACGAGCCAAGGATTAGCTG
GCAGCATCGAACCGTGAAGATTCCTGCCACTTGTTCATCAGATGGCCATCTGATGAACGTCTTAGAGCGTCCACAAGCGTGTGGATGTACTGAGTGAGTG
CGATGGCCTCACTCGCGGTACGGTCGTTAGTACGACTGCACAAGATCACAGTGTGACAACAAATCACACTGTTGAGGAAGCTGCCGGCAGCTGTGCGGAT
GCACAGGCAGCGCCGAAGGTCCACCACTTGAACAAGTTGAGTGGATCGGGACATAGGTGTACGCCTAGCGGGCGACATACTAGTAACAATAAACTGGTTG
CCCACACAGGGCAACACGATGATTCTAGATCGGCTGGAGAGTCGATAGTAGATGACATAGCGGTGGTAGCACAATCATAGCTAGAAGGCGTCGAGGGAAT
AAGCAGCCTGTGGAAAAGGGTTCCCAAGAAGAAACTGAGACATTGAATGTCTTGGTTAATGACGGGTCAAGTGTAGGCACCTATACACTTGATCTGATCG
CACCTCCGAAGTCGACTTCGGAGATCACTCAATTGCCAACGCTAGAACCGAAACGGTTCTTGCGAGATCTGCGTAGTGGCAAGGTCAAGCAGATCTGTGT
ACTCGTCATGGAGGACGAGTACGTGACTGATATTCGGTCCGCAGTAGTATTTGCCGAGAACGAACGGGTTTTCAGTAGCTCTTTGATGGACGAAAGTTTC
CTAGATGAGAAGACTTGGATTGAGCGATACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAATCCTTTATATAAGGATTTGAATGAATTCAAGGGCGTGT
TCCCTGAATCCGTACCATGCGAATTGCCTAAGGATCGAGGCACTCGACCTAAAATCGAGCTCAAACCGGGCTCGAAGTACTGTGTCATGAAGCAGTTGCC
ACTGCCTCGTGAAAAATTACTTGCGATTGACAAGTTCTTTGCCGATCGCTTAGCTGCGGGTCATGTGAGGAAGTCATCTTCCCCTCACAGCTCTCCGACC
TTCTGTGTGCGCAAGGCCACAGGAGGATGGCGGATAGTGCACGCGTTTAACAAGTTGAATGATGCAACGGTACCAGCTCAGACGCCGATACCGAGGAAGG
ACGTAATCATTGATGGTATGTCAAAGAGTACCATCTTTTCGTCCATGGATTGATGGATTGCTTCTATCATATCCTAATGCGTAAACGGGACATTTCGTAC
ACGGCAGTAAGCACCCCGAGCGGCATGCTCTGGGAGTGGCTAGTAATGCTACAAAAGATTAGTAACGCACCTGCCACCTTCAACAGATGTGTTACAAATC
CGTTGAGACCGGTGCGAGACTTCGCACCGAGTTACTTCGACGATATATTCGTCCGTAGCCGGGTTATGGGCGGAATGAAGGACGTAGAGGTTCATAGAAC
TTTCGTCAGGTTCTTACACTTATGCGCGAGCATAAGCTGTACGCCAACCTCAGGAAGTGTATATTCGCTGCTAGCGAAATACTATTTCTTAGGTGCATCG
TGGGTAAACATGGCGTACGACTTGATACTGAAAAGATCAAGGTGATTACCGACTGGCGTGTGCCAGTCGACGTTAAGGGACTAAGAAAGTTACTTGGCCT
AGCGGCGTACTTACACAAGTACTCGCGCACCTATGCTGAGATGACCGTTCATATCTCTCGTCTCTTGAAAAAGAATGAGAAATGGTCATGGAACGCTGAT
TGTCAGCGTTTCTTCGAAGGTATCAAGCAGATCTTGATGCAATCGCCCATCTTGGAGATTGTAGACCAAGACAGACCAATCCATGTGGTCTGTGACGCCA
GCGATTTTGCAATCGGCTGCGCGTTAATGCACTACGATGCAGACGGCGCAGAGCGTGTCGTCTGTTATCAATTGCGTCAGCTTCAAGCAGCTGAGAGTAA
TTATCCAGTGCATGATAAGGAACCACTTGCCATGAAGTATGCAATAGCGAAGTTTCGCGTCTATCTCCTTGGAGATAGGCCGTTCGTAGTCAATACGGAC
CATGCGTCATTACGCACGGCCGTAAAGAGCCCACATCTCTCACAAAGGATGGCGAGATGGATGTCCTTCTTCGCGGAGTACAACTTCTCCGTAGAGTATA
AAACCGGACGGCTAAATGTCGTCGAGGACGCGTTGTCGCGTCAACCCGATTTCGAGTTGGCTGTGCAGTCCAACAGTGAGGTCGATACCACTGTTGCAAC
ACTAGTCACTAGTGTCCCGTCTTCAACATTGCTTGACGACATCAAAAAGGCCTACATAGAAGATAAGGCTCTTCTGCGACTAATGGATCATTTGGTTACT
CCATCTCGAAAATATCTCAAGGATTTACTGGCCTTGTATCGATCTTCCGCGGATCAATACACAAGACGCAACGGGTTGCTGTATCATACAGCCGTTGCCG
GCGACACACCTTGTGTCGTTGTCCCTACTTATAATGATTTGCTTTTACTCATCATGTATGAGTGCTACGATTCACCAACAAGTGGGCATCGTGGGCGTGA
GAAGGCTTATCTCACGGTAAGTCGTGACTTTTACTGGCCCCGCCAGTATCAGTTTGTGCGCAATTACATTCTTGCTTATGAAGTGTGCCAACGGGTGAAG
CCCAATCCATCATACCGTGCCCTACTACAGCCTCTACCAATCCCGGCTGAGTGCTGGCATTCCGTTTCAATGAATAGACTTTGTCTACAGCTTCCCCGAA
GACGCTCACAAGAACAATGGTATTCTTGTGTTTGTAGATCGATTCAGCAAGATGGTACATCTTGCTGCAGTTAATGATTCAATCTCAGCACATGGTTGAG
CCCGTGTCTTCATTGACAAGGTATTACGACTCCACGGTCTACCCCGTGAACTAGTCTCTGATAGAAATCCTAGGTTCACGGCGACGTTTTGGCAATCCAT
GATCCGATCCCTCGGAACACGTCTGACTATGTCTACTTCTGACCATCCCGAGACTGGTGGTCAGACAGAACGCGTTAACCGCGTCCTCGAAGAGATATTT
CGAGGATACGTTCAATCTTTCACAGATTGGAGCGAATTTTTTGCTGAGGGTGAAGTTTTAATCAACAATTTCGTGCATGCATCGACAACGCATACACCAT
TCTTCGTGGATGGCTTACGCCATCCACGCCTACTTACCCATTTAGAGTGTGACAATAATTTAAGGGGGGGGATTCGCTCGAGCAAAAACCGTTCTGGCTC
TAGCTCATCACGTGTCGAGGTAATTAACGACGCGAACGTTGCCGATGTTGATGAAGTGGACATCGAAGAAGATAACCTTATCAATAGTGATGACACTATT
GATGACCCAGATAAGGATGACGATGCTGGTGTATTCAGCATCGCCAATGACTACACCAGCTAGGATGAGAACACCCTCGCTGAAGGAGAGGATGACCTCC
TAGCGGTGCGCACAAGGCGCACTGCAACAAACCAAGGTGATGCAGTAGAAGATTTATTGCTAGCACGAGAAGTAGTGGTCCGTTTCGTGCAAGCCTCCAT
CGCTAACTCGGTGGACCGGCAGAAATGGAACACTGACAAACATGGAAGAGCAAACGTTCTTCTATTTAATGTCGGAGACTTAGTTCTACTGTCTACGGTT
AATATAACTAAGCACGTAATAACTAATGTGGCTAGTAGTTTACTACTAATCAAGTACATCGGCCCATTCCGTGTACTACGTCGCAAAGGCAATGCGACCA
CAATCGAGTTGCCTCGCAGGATGCGTACGCATCCTACGTTTTATGTCGGTCGTCTCCGCCCGTACCATCACCACGAGGTCTCTTTCTCGGGCGA