Description :
From Genome Similarity Track
Location :
Scaffold_26:51173- 53105
Transcript NameFunction/comments
g4259.t1RAW31493.1 hypothetical protein PC110_g12177 [Phytophthora cactorum

Sequence
1932 bases(100 bases per row)
ACCATCACGTTCCAGAGTCTGGACGCGGCTTCCTCCTCTGCGTCGCTACCGTCCGGCAACTCGTCGTTCGTCTTCGACGGCTCCAATTCCGACATCGCCC
AGCAGCTCTACGTGCGCTACAAGGCCGGAGACGCGTGCGACCAAGCCACGCTCACGTCCATTCCTACAGCGGTGACGGACCGACTGGAGCCACTCAACAT
CAACTTTAACAGTCTTCCGGGCCTTGTCCAGCGAGCTGTTCTTTGGGACTCTGGCTTTGGGATCTCTCCTGGTAATGAACCTATTCAGATCTGGACCCTA
GAGAACTACAGCATGGCTCAGATCGCCGTCCCCAAGTACGAGGTGGCCAATGTGGACTGCACGTTCCTCAACTGCTCGCAGCCTAACGACGTGGAAGCCT
ACTACACGAAGTACTGCACTGGGTACCAGATCCTCAATGCCTCTCGGTGTGTGGCTGATACCTTTGAAGATCCAGGAGCCGGGGACTTCTTAGGCATGAT
GTGGTCGACTGGAGGAGACCCAGACATGACCCCGGAGCTGCGGTTCCGAGACCACACGTGGACGCAGGATGTCGAGCAATTCGGCGGGAACATCACGTTC
TCCGTCTACTCGGTGCACACGGTGTCTAGCTCAGAAGACCCTGCTTGGGATGTGTGTCCCTCGGGGTACGCTTCCGTAACGGTGCCCTGCCATAGGAGAG
ATGAGTTCACGGACGCATTCATGGCTGCTAACACGACCAAACCGACGGGGAGTGCGTGGGTCACGACGTGGTTGCAGCAAGAGTTTGCTCAAGACTCCGG
TTTTGATATGCTTCTGTTCATCCCGATCGTGCTGGGTGCTGTTGCTGTGGTTGGACTTGTTGGTGTTTTCTGGCGGTGGCGAGTGAAGAAGAAGGAGCAG
GAGAAAACGTTGTCCAATGCGTGGGAGCACTCTGGAGACTACTCGTATTTTATGAGTGGGAGCGAGCCTGGGGAGATGGTGCTGCGCCCCATGATCGTCA
CCAGCCAGCTGAGTACGCAGTTGTCCAGTCTTTCAAGCCACTACGAAAGTGCCGGCTCCAACAAGACGCTCAAGATCCTGCTCGGCAGCGAGCACCTTCA
AGATAAATACATGCCATTCGACAGCTTGGTCTTCCAGAAAGCGCTATCCAAGGGAGCGTCCGGAGAAGTCTGGATCTGCGAGTACAATGGACGAAAAGTG
GCCGTCAAGAGACTGTTGCAGAGCAAGGAGCAGAAGGCGCAGAATGTCCAAGCGTTTGCCGAGGAAATCGAGCTGGGTGCCAGTCTCGTTCACCCGCACA
TCGTCGAGTTCATTGGGGTGGCGTGGAATACTCTCAACAACTTAGTGATGGTGCTGGAATACCTGCCCAAGGGGAGTCTCCAACAGTATCTGAAGCTTGA
CGGGAGCCAGTTGTCCTGGTGGATGGGCAAGCTTCACATGGCCGTCGGAATCGCCCAAGCGCTGGAGTACCTCCATGGTCGCAGCCCCTCTCTGATCCAT
CGTGACCTGAAGTCAAGCAATATCCTGCTCACAGAAGAGCTAGAGCCAAAGCTGATCGACTTCGGCGTCAGTCGCGACCGGGCTGAAGCCACCATGACGG
GAGGCATCGGGACGCCCTACTGGACAGCGCCAGAAATCCTCATAGGCAAGCGCTACACTGAGCAAGCAGACATCTACTCGTTCGGCGTGGTGTTGTCGGA
GCTGGATACGGGGAAGTCTCCATACTCCGACACGTTGACAGAGTGCGGCGGAATGCCAAAGCCATTCTACATTTTGCAGGATGTGATGGCCGGCAAGCTG
CGCCCCAGCTTCTCGCCGACTTGTCCTCTGCATGTCTTGCAACTTGGACTGTCGTGTTTGGCGATCGATCCGGCGAACCGCCCGACAGCTCGAGAACTGG
TGCAGTGGCTTGAAAACAGTGATGGAGAGCAA