Description :
From Genome Similarity Track
Location :
Scaffold_156:51173- 52997
Sequence
1824 bases(100 bases per row)
AGCTATTCCTCCCGGTTGTCACTTTAGCTCACTGTACATCGGGGTGTATTTGACTTTTAACCCAACAATTCTATCAACCTTGTGATTCTACTGCTGTACA
GTATTTGTTCCTAAATACCAATAAATAGTGTGGTATCACCTGAGCGGTAACCGCCGAAGTAGCGGATTGACCGAAAAGTGCAGGGGATTTTTTGACCAGA
AACCGTGGTAACTGTGATGTTGACCAAGATGGCGCAGGACGGTCTGGATTTGGGTTCGCTCGTCGACCAGCGTCGTAGGAAGCTGTAGATGCCGACGGAC
TTGCATAGACCACTGCAGGAGGACGAGCTCTAGCATGACAGGGATATAGGGACCAGCTGTACCTTCGTATTTGACCTTCTTACGATAGATCCAGAGACGT
GTCGCATTAGCTCATTGTCATTGTCAATGGAGGTTTATTAGAATTTTAACCGGATATGATTCCTAACTTAATATTGCCTTCTCGCGTTATCCGGCTGATT
GGGCTCACTCGGGGGGGGGGTGTTGGTTGTGTTTGGTTATTTAACCGAACCGCGGGTCCTCTTCATCCGGATATCCCTTCTTTTCAGGTGTCGCGTGACG
GTTTTTGAATTCACCCCTGTCGCATTGTCGCATTAGCTCAGTTGGTAGACACCCCTGTCGCATTAGCTCACTGTACATCGGGGTGTATTTGACTTTTAAC
CCTACAGTTCTATCAACCTAGTGGTACAACTGCCGTACAGTATTTCCTAAAATAAATAGAGCGATGTTCACTTGAGCGGTAAGCGCCTGGTCAAAGGATT
GACCGATAAGTGGAACGGATATTTTGTCCAGAAACCGCGGTAGCTGGGGTCTTGACCAAGGCGGTTCAAGATGGCTTGGAAGCGGTTTCGTCCATCGCCG
AGTGTCGACGGTAGCTGAATGTGACGGCGTACTTGGGCCGACCAGTTGAGCAGAACAAGTTCCAGCACGGACGGTATATGGAGGTTGTTTGCGCTTTCGT
ACTTCACCGTGTTGCGGTAGATCCACAGGCGTCTCAGCACGCCACCGGCGAGCATCGTCCACAGTACAATGAGCTCTGTGGCCACATGGGACCAGTCTTG
GGCAGGTTGTAGTTTGGTATATCCAGAATGTAGGTCCATTCGAAACTCAGGCCAAATTGTAGCCAAGGAGCGGACACGATGTCCCAAAGCGGCCTGACGT
GGGAGCAGGTGCGCAGGGCATGTTGGATAGTTTCTACGGCGTGGCAATCTCGATAGGGGCATTGTATGCAACTGGGATTTACTAACTGCATGTAGTAGAA
GCAGTAGCCAACCGGCAGGACACGGTATTGCAGACGGTTCCAAACATCAGCCAGCATGGGAGTGGCGACAGCGACAGAGCGTCGGAACAGTTTAAGGTAC
GTTGCCACATTCTCCATAGTGCCGTGTGTACTTAGCATGGGGTGGTTACGGGTGGGTTTGGGTGGGTTATAACACGCCCATTTGATTTGTGCCGACCATT
CCCGAAATTCCGTTATTGTATCCTGGTAGGACGCGTTAAACGGAAGACGCCAAGGGAGCTCGAGTGGTACGGCATGTGTAAATTCATGGCCCGCGTAATC
ATAGACTTGCTGTGCGATGGTGGTAAGTCGGCGGTATACTGGTGCCAGGGAGTATGGTACTGGTCCATTATACTCCAATCGTCTTATTGCAGGTACAACG
ATGTCGTCGAACTCGTCGGCAGTTGGCCACGTACGAGCAGGGGTAAGGAAATCCCTTAGACAGTGTAAACCCGATCTCATCATGTGTTTGTACCACTCCT
TGCCCTTATGGCGATGGGCCGCCT