Description :
From Genome Similarity Track
Location :
scaffold_115:51141- 53244
Transcript NameFunction/comments
g3933.t1hypothetical protein
g3934.t1 endomembrane protein 70-like protein, putative

Sequence
2103 bases(100 bases per row)
ATGTACGTCCCGCACGGAGAATACTGGTAATCAATTTCCTTCACGATATTGTAGTCGCGGAACTTCTGGAACGTGCTCTGAAGAATGTTCAAACTCATCG
ATAAATACGCCGAGCTTGCACTAGGTACCGCCCCGGTATTCGCAGTTGCAGCCAAGTCAACAAAACGCTGCTGCATTTGAATGGGTAGTAGATTCACCAG
TGTTTTCGTCGCCTTTGTGATCGTGACAAAGCGCTCCGTAGTCTTCGAAGCGATTGCTGTCGACTGCGCAACATTAAGAATGCTCGGAATGCAGTCGAAC
TCATTGACAAAGGTAATCACACGCTTGCTAAGTTTCAGTGGCTCCAGAAACGCCGCCAAGCCAGTCGATCCAATGTACGGCGCTCCAAAACCAACCGCCA
GCATGTGCGGCGTACTGCGAAGAATCGCCGCGCGCTCTTGGTCAGACATGCCTTGAACCATCAATCGAAAAGCCAATCCATCAGTTGTTGCAGCGCCATT
TTCTTTGCATTCTTCTTGCTTTTGCTGGTCATAGTCGCGCTTTTCGAGAAACAGCCGCGTCTTCGTGGGCAAGTGCTGGTACACCAGTTCGCAGAACGCC
AGCTGCGCAATGCTGCCGCCAATGGAGTGGCCACAGAGCAGCAACATCTTCTTCGCTTGTCGTGCTTGATGGTGAATGCCTTGCAAGTCCAGCCGCTGCG
TTCGTGTCCAGAACGGAGCGTGGATCCTAGCGCCGCCGAATCTGTGCACGTACGGCTGCGAGAGCAGCACAGTAGAGCCCACAACGGTCTGTAATATGTC
CGCAGGCTTGGTGGCTCTTATAGCGCAGATCACCGCCAGCTCAGACTGGACGAGCACGTAGTCGCGCGTGAACGCCAGCACGGGCAGCTGCAGACTGTGC
GGCAGCGGCGACTTGCGCACGTGCATCTCCAGCTCTCGGACGGCGCGGTCGTTGGCCTGTTTGTCGGTGTCTGAAGGCTCTGATTGAGTCGCAGACAATG
CTGCACATAGCACTGCAGCGTTCAGCAGCTCCGTCTCGCTGGACACCACTGCGTTCACCTGGTCACTGTCTACTGCCGAGTCGGTCCACCACCACGCGCG
TTTGGGGACATTTTCCGCAATTTTCTTAGGCTTCTTGGTCGGTCGCGAGACTGCAGACGTCGACGCCATGGCTTTGGGCAGTTGGATCGCTTTGTGGTCG
CAGATAAACGCCTTCGCCGTAGTGTTCTTCCTGGTCTGATTTGGCTGACTCGTCGGAGTGACGAGCTCATGTGGAATGTAGCTATGATGGAAAAGAATGC
GACATCTGACTTTCCACCAATCAAAATGGACAAGACGTTACGCAGGGGGCTCATTTGAAGCTAGCTTGTGACCATGTGGACGAAGCTGCTGCTCGTTGCG
GCCACACTCTCCTCTGTGGCGGCTGAAGATGGCTACAAGATGCGCGACGAGGTGGAGGTCGTAGCGAACACGGTGCGTCTGCTGTACCAGTCGATATAGC
ACTGTAAATGGCTTAATAAGTAGACGATGACCGCCCCTTCTCAGTGCTGAGTCTCGTGCATGTTGCTGCAGATCCGTCCGTACGCAAACCCGACCGAAAC
GTACCAGTATTATAAACTGCCATACTGCAAACCCAAGGAGCGCCAATGGGACGACCACGACCTGGGCGAGCTGCTCACAGGAAGCCGCAAGGTTGTGACG
GACTACCGCCTCTACTTTGGCGTGGACCAAACGTACGCGCAGCTCTGCAAACTACCAGTCACACCCGATGTTATGAAGGCATTCACAGATGCAGTAGATG
AAGACTACGAGTTCGAAATGTATGTGGACGACATCAGACTTCGAGGACAGGTGGGATACCTCATCCAGGAAGGCATCCGAGAAGGCATGAAAATGCACTA
CTACCTCAACACGCACTTGCACTTCGACATCGCCTACAACGACGTGGAAGCGGAGGAAGGCAGAAACAAGGTAAGAATACTGAATAATTGTATGCCTTCT
CGGAGATATTTAACTTTTAAAACTGTTATGCTGCTCAGATTGTGGCTGTGAACATGACGATGGCATCGTCCGACCCCGATCTTGAGTACCACTACGCGCT
GTC