Description :
From Genome Similarity Track
Location :
Scaffold_147:5112- 6171
Sequence
1059 bases(100 bases per row)
GAGAAAGAAGAGGAGCCGGTGAGCGGAATGCTCCCAGTGACCCAGGTCGAACCAAGCCAAGGCGGAGATGCAACCGACATGGATGAAGCGAAGTATGTTC
ATGAAGGGGCCGATCTCACTGCGGAAGACATCGAAAAGGAGATGGCGGTGTCACCAGAGATCTCCCTGACGGCAGAAGTTAAAAGGGAAGATCTCAAGGT
CGGGGATCCAACTGAGAACACAGCAGAGGAGATTGATCGTATGCGTGATATCATTTGGGAGCGGCGTCACCTTCTCATCGGCAAAGGCAATGCTTTACCC
CCTGCGGTGACGGGGGCGAACTGTGACATCGACGTTGGTGGTGCACGACCGGTGGCTCAGCGTTGTCGCCGGATCCCGCCTCAGTTCCGTGAAAAGGTGT
TCCAACTCGTCAAAAGGGCTACTGGGGGCGAAGATTATTCGGATCTCCACTTCTCCTTGGGCGTCTCCGATCGTTATCGTCGTCAAGAAGAACGGCGTGG
ACGTCCGACTCTGTATCGACTACCGTCTGGTCAATGCTCTGACACGACTGATGATCTACTCCATGCCGTTGATTGACGACCTCCTCGAAGATCTCGACAG
TTTGCTGTGGTTCTGTTCTCTCGACATGGCGAGTGGGTTCTGGGTGGTGAGTATGACCGATCGAGCCCGAGAGATGTCCGCGTTCATTACGCCGTTCGGC
CTGTTTGAGTGGCTGCAAATGCCGTTTCGTCTGAAGAATGCCCCCAAATCTATCAGCGGCTGATCGACAATGCGTTATATGGCGTGCTGCGGATCTCGCA
GGGTCAAGATCGCGCGGATCTCGTCAACATTTTCGAGGAAGGTGTTCCTGAAGATCGATCGCTGCCGTCGGTGCTGGGGCGTCGCTCTTACATCGACGAC
ATCTTAGTTGGAGAAAGCTCGTGGGACGAACTGTGTGAGAAGGTCAAGAAGCTCCTAGAGGTTTGTGACCGCTGGAATCTGTCTATTGGCGCGGAGAAGA
GCAGTTGGGGTATGAGCAAAGTCGACTATCTGGGGCATCAGATCTCCGGTGAAGGCCTG