Description :
From Genome Similarity Track
Location :
Scaffold_59:51119- 52374
Sequence
1255 bases(100 bases per row)
GCTTCCTCATCACTACGTGTAAGCAAGTAACGGACACCCCAGGCCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCCATGACCAAGCTCACGATGAGCC
AAGGTATGACGTCTGAAACTCCAGGGCCGACCCTGAAACATGCTGCTTTCCCTAATCTCACTCGTGTCGAGTGGGAAGCCCTTCACCGCCTCGCGGCGGT
GTCTGGTGAGGCTGTAATCGCGTCGCTGCTGAGCTCAGCGACGTCCGACTAACAACGCCAAGAAGTCCAAGAGTTCATGGAACGCGAGCTAGCCGATGCG
AATCGGCGAGCAACAACTCCCGCGCGTTCCCCGAAAAATGATGTCGTGAAGATTGAGACGTCTGCCTACTCCGGTGAAGGAGCGAATCGCCTCCCGCTGA
ACCGGTGGTTTCGCGGAAGCGCCATCGCTATTGCTTCGAGAATGATTGAAGTACAAGGGACAAAGGTCAATTTCTTTTTGTCCCGGTTGTCCGGGAAGGC
CAAGGAATGGGCCCTCGGTAAACTTGTCGTTGATCACGACGCATTCCCCACTCTGGAGTCTCTCCAGAAAGATCTCAGGCTCACGTTCGAGCCGCCTCAA
GACGAGTCCCGCGTGCGTGCCGAGTTCTTCGCCCTTCATCAAGGTAAAATGACTATGCGCGACTACGTTCAAAAGACTCGCCACCTCGCGTCATGCATCG
TGACAAATCCGATTGACACAGCATCGCAGGTCTATGTATTTGTATTCGGCATGCGTGAAGGCATGACACGGTACTGCCTGACCCGAGCGGAACCTTCTTC
TCTCGAGGAAGCATTCGCCCTCGCATTACGCGAAGACTACGTTGTGGCGGCGTCTTACGCGCGCGCGATGTCTACGGCAGCTCGTGAGTCAGCCCCCGAG
CCCATGGAGATCGACGCGATTGACGCGTCGAATAGTCACCGTCAGGCGACTTCTCGTGGGCCCAACGGCCGTCCTAAGCGCCCGCTTACTTGCTTCCGCT
GCCGGAAGATCGGTCATCACGCGCCAGCGCCGGTACTCGCGCACACCGCCGAAGTCTCACCTGCCGTTCAGTCAAAAAACGGTCAAAGCCAGTAGGTGCA
GGGCGCCCTACTGGCTGGAATGGAGGTCCGGGTCCCCCGGTGGCTACCCAACCTTCTAGCCCTCCTGTGCTTCACGCACACTTTAATGCCACCACCACGT
CGGGCGACTCGAGGCTGATCATCGTCAGGCTTCATGTCGCCGGCGCCCGGCGACC