Description :
From Genome Similarity Track
Location :
Scaffold_227:5111- 11815
Transcript NameFunction/comments
Physo_144646reverse transcriptase
Physo_144647hypothetical protein

Sequence
6704 bases(100 bases per row)
TCGGCTGTGTCCGAACTGAAGGACTTCAGCGGCAAGGAACATGACGAAGAAGCCGCCCGAGCCTGGTTCAACAAGATTAGAACGGCCTTCCGACGGGATC
AGATGCAGCCAGACGAGATGTGCTTGACATTTGCCGATTTGATGATAGGCCCTGCGCGCAATTGGTATTACCAGCTGAGCCGCACCGCTCGCGCGTCGTG
GACTGACCTGGGTGAACAGTTCCAGATCCACTTTTGCGGTAAAGGGATCTCCCTCGCGCGCAAGTACTACCACATGCGGCGCGGGAGTCGGGAAGACCCA
CTGGATTACTTATACCAGCTGAATCTGGCCGGGATACGTGCAAACTTGAAGATCCATGATGGCACCAAGGAACAACGACGTGAACACGTCGACCACTACA
TCGATACAGTCCAAGATGACGATCTCGCCGGATCTCTGGTAGTGTTGAGGCTGCCTGACTCAGAAGCTCTCGAAGGCGTCCTGTTGGCCATGCGACGCCA
CCACCAACGTCGCAAGATTGAGACCCAAGGTTCGAAATACCGCCAAAAGGCTCCCGCCCTTGCAGCCTCCTCGAGGGCGGTGCGGGTTGTGACTACCGGT
CGCGGACGCCGCGGAGATCACGAAGGTCTCAACGAGTTCGAGGGCGAATCAAACAGTTCCGATAGCGAATCTGAAGAAGAAAGAGCGCACGTGTTTTCGG
CAGCTAGGACGCCTACACAGGGAGATGGTGAACAGCCAGGGGCGCCCCCAAGACCGCGAAGACCAACTGGGGCGCCCGAAGTACGACACTCGATGCTCAC
ACTGCGGATCTCGCAAGCATACGGATCTCGGGTGCTGGAAGAGGCTCACGTGCCAGAAGTGTGGACGCATGGGCCATCCTACCGACAAGTGCTTCTACGT
CTGCAAGTGCTGTGGAGACGTTCACGAAGCAGGTCAGTGTAAAATCGGCGACTTCTTCGATGCTGTTTGCCAATGGTACAACCCGACTCGCCATGCCGGA
CTGCTGCCCGAGAGCGTCGAGAAGGCGTTAAACTAGACCGCTCGCCAGGCCTGAACAGCCTGGTACGTGACGAGCGATCGAAGTTCTGCATTTATGCATA
TGTTCAGAGGAAGGCGCGAGCGTTAGAAGACCCAACTTCCTGTAATGCGGTGAATACAGCCAGATCTCTTACCTCGGATGAAGATGACTATTCGCGTCGC
CCTTGTGTGATGGCCCTTCGACTGTCGCCGGGTGAACGCCGAGGTTACTGGAAGTATTACACTCCCTCCAAGTGGTTCAAGCAGTCGAAGGCGACCGGTG
CGGTCAACAATGTCCGCGCCGTCCTACTCTTTGATACTGGAGCCGAAGTGTCGATAATCGACTCTACCTTTGCACGTAAGGTGGGTTGTGAAATTGATAC
AACACAGACAATGGATTGTGTTGGTGTGGGGGATGTTGTGTACCGCACAGAAGGCCGAGCAGAAGTCAAGCTCACACTGGCTGGAGAGTTGGTGTACAAG
TTCCGTGTGTGGGTTGGAGATCTCTCAGGACAAGACGTCATTCTCGGCATGGATTTTATGGTTCCTGCGGGGGTGAGGTTGGACCTGGCTGACGGAACGC
TCTGTCTGCCGGACGAAGTTCGCATCCAGATGACCGACCGTAAGCCACTGTATAGCAGCAAGGCTGACGCGGTCTACGCAACGGGATTCCATGAAGTCGG
TCCTGGCCAATGGACAGAGATCTCACTCAAGTCCCACAACAAGCGGTTTGAACTGTAGGGGGAAAATGGGTGATCACGGTGGTGAATGGTGGATTCGGTA
ACAAGTCATACCTCCGGATCACCAACATCAGCACGAGCCGCCTGGTACTGGATCGTTTGGTGTGTTTGGCAATCTGGTTACCCGTTGGGCAGATCCCGCG
TCGACCTGGATTCGCTAGGAAGGATTCAAACCGCTATCGGGAGTGGCAAACACTTGCGTTCGAAGCAGCTGTGGACACTGGAGATGCAAACGAAGCGGAA
GTTGAAGAGTCTGGACCGCTGGTCGAGCGTCCTAGCTACCGGACTCCGACTGCGATTTTAGCACGGCCTCCACAAGTGAAGACCGTTGAAGCAGCAGCAA
CGTCAGAAGAATGCACGCGACTCACACTGGACGACACACATCCTCAAATGCAGCTGATGAAAAGTTCGACTGATCCGACTAGGGTGACCAAAACCGAGGA
GGACGTGATCTCTACCGACCCCGGTCAGGTGATCTCTGGTATGGACAGCGATGACTCCAGTCTACCGCGTACGGAAACTCACGCAGGCGAGGAGAGCGGC
CTATCCTTTACGAACAGTGGCGAAACACCGGTAGGCTTGGCGTCGACTCCGGCAAATGTGGCTGAGGCCGAGCTCCGCAAGGAGTTCCCAGAATATACCC
CTGACCTCATGCCACAATCCAAAATACACGCCGCGACCACCGAGGAAATGGTTCATCGCACGTTGTCGGTCATCGTTGAAAGCGACTGGAGCGACAGCTG
TGGCTGTGCGTCCGATAGCGCTGAGTCTACTGGTAGCTGGGGTAGTTTTGACTGGCAGACCGACGACGAGAAAGAAGAGGAGCCGGTGAGCGGAATGCTT
CCAGTGACCCAGGTCGAACTAAGCCAAGGCGGAGATGCAACCGACATGGATGAAGCGAAGTATGTTCATGAAGGGGTCGATCTCACTGCGGAAGACATCG
AAAAGGAGATGGCGGTGTTACCAGAGATCTCCCTGACGGCAGAAGTTAAAAGGGAAGATCTCAAGGTCGAGGATCCAACTGAGAACACAGCAGAGGAGAT
TGATCGTCTGCGTGATATCATTTGGGAGCGGCGTCACCTTCTCATCGGCAAAGGGAATGCTTTACCCCCTGCGGCGACGGGGGCGATCTGTGACATCGAC
GTTGGTGGTGCACGACCGGTGACTCAGCGTTGTCGCCGGATCCCGCCTCAGTTTCGTGAAAAGGTGTTCCAACTCGTCAAGGGGCTACTGGGGGCGAAGA
CGATTCGGATCTCCACTTCTCCTTGGGCGTCTCCGATCGTTATCGTCGTCAAGAAGAACGACGTGGACGTCCGACTCTGTATCGACTACCGTCTGGTCAA
TGCTCTGACACGACTGATGATCTACCCCATGCCGTTGATTGACGACCTCCTCGAAGATCTCGACAGTTTGCTGTGGTTCTGTTCTCTCGACATGGCGAGT
GGGTTCTGGGTGGTGAGTATGACCGATCGAGCCCGAGAGATCTCCGCGTTCATTACGCCGTTCGGCCTGTTCGAGTGGCTGCGAATGCCGTTTGGTCTGA
AGAATGCCCCCCAAATCTATCTGCGGCTGATCGACAATGCGTTATATGGCGTGCTGCGGATCTCGCCGGGTCAAGATCGCGCGGATCTCGTCAACATTTT
CGAGGAAGGTGTTCCTGAAGATCGATCGCTGCCGTCGGTGCTGGGGCGTCGCTCTTACATCGACGACATCTTAGTTGGAGCAAGCTCGTGGAACGAACTG
TGTGAGAAGGTCAAGAATCTCCTAGAGCTTTGTGACCGCTGGAATCTGTCTATTAGCGCGGAGAAGAGCAGTTGGGGTATGAGCAAAGTCGACTATCTGG
GGCATCAGATCTCCGGTGAAGGCCTGTTCACCAAGCCGAAAGATTTGGCAAGTCTGGAGGCGTTGAAGTTTCCCAAAACGCTTAAGGCTCTCCAGTCATT
CCTCGGCAGTCTCAACTACTACAATCGCTTCATCGAAGATTTCGCAGTATATGCCACAGTGTTGTATGAGTTCGGAGATTCCGATTTCATCAAGGGTCGA
GCGGAAATCACGAGGCGACTGTGAGATGGGGCCACACGCTACGAGCCTTCGATACCCTGAAGTTCAAGATGATCAACGCACCCATGCTCTACCATTTTGC
CCCGGAGTTGGATCCTGTTGTGATTGTGTACGCAAGCAAGTGGGCGATCTCTGCCTCTCTCGTTCAGTGTCGTGATGGAGTGTACGTACCCGTCAAATTT
ACGAGTAGGACACTGCGGTCTCACGAGATCGGGTACGACATTGTGGAGAACTAAGTACTGGCTCTGCTAAGAATCCTCGATAGCTGCTTCACCATGCTGA
GTGGTCGACACATCCGAGTGCTCACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCGAGTCAAGGTCGGATACGCTCGGAAGCTCGCTCACATGTGGCATGGGCCTTTCAGAGTCGCCACCATGGTGAGCGACTA
CGCTGCCAAGCTGGAAATCAGCGGGACTGACTACCGACTGTTCCCTATCGTACACATCTCGAAGCTGAAGCTGGTCCGACAGTTCCCCGAACGACCCGCC
GAAGATCTCACTGTTGATGAAAGCGAACGATTTGACTTTGACGAAGAACTTCTCCCCGAGGATAGCTGGGAGGCACAAACTCGCGGTGACAACGAGTATG
AAGTTGAAGAGATATTGGATGTCAAGACGGAGAGACGCACCCGCTACGGTCGATGGCTCAAGGAATATTTGGTGCGTTGGAAGGGCCACACAGAGACGAA
TTGGGTCAAGGAAGAACACCTGAACTGTGGTGGTCTTCTGTTCGACTTCCAGCAGAAGCGACGGAGCCGGCAGAGGTTCCATGTGATGCAATCGCGTGGA
GAGG