Description :
From Genome Similarity Track
Location :
contig_19:51107- 52573
Transcript NameFunction/comments
g4314.t1hypothetical protein PHYSODRAFT_340835

Sequence
1466 bases(100 bases per row)
TTCTGGTTGATCTCGTGGTTTGAAGTTTGATAGGTAGCTGTGCATCGGGTCTGTTGTTGTGCTGGGTTGTTGTAGGTCAAATTGTCGAGTCTTGTGGGTT
TGTGTCAGTGTCCGAACTGCTTCCAGGTCGGCTTTTGCTGGTGTGCTCCATTGCACAACGAAGAAGCGCTGTAGCTCTTGATCCAGTTCCTGGATGAGGC
TGTCGCTCTGTGTTGTCGCTGGTTTTGCACTGAGGGACTTCTGGATTGTTTTATCCACACTGTCACTTCGGAGGTACGTCTTTGCTGCGTCTCCGAGCTT
CTATAGTAGTGGTGAATGGATACAAGAATACCATTATACATATCAAAATGCTACAGGCTTGGCGCCTCGAAGCTCTATGTGCTGGAGCCCCACGCATGGT
GATCAGCATTGCCTCGCACTGCAATTGTACTATAATTTGTAGTGGGGGTAGAATCTACCTCAGTCGAAAATCGGCTCGTCGCTCCACTCGCCCTCGGACC
ACCACACTTCCGTGTCTGAATTCGCGTCCGACGCAGCATATCGCCGCCACTCCGTACCGTCGTAGTCCTCCACCAGGCCGTACTCATCGTAGCCGTCGCT
CTCGTCCACAGGACTCGCGCTAAACGACCCTGCAGACTTGACGGATCCGCTGGATGCGCTCGCGCCATCGGAATCGTAGATAGCGAACCACTGCAACTGC
CGCTGCACAATGTCCACGTTGCCCGCACACTCCTGCAGCATTTCGTCCACAACGCCGTCGTAGGCAAACGGCTCCTGCCCGAAGTTCACGTGGATGGCGT
CCGACGAGTCCAGCCCGACGGCCGGATACCACTGCTCATGCACGCACTCCATGGCGCTGCCTTCGTTGCCAATGAGCTCGCCATTGTTCGTGAACATGAC
AAAGGAGCGGCCATCGCGCACGCTTCGCCGCACGCCGCAGCCGATGGTATCGCTGGTCCCGAAGGCTGGGCCGAATTGTCGCCCGCGGTTTGAGTGGAAC
ATCTGACCGTCGTCGCCATGGTATCCGTAGGACCGGAAGTCCCAGCCAGGCTGTCGGTCGACGAGCGGAAAGCGCGAGGTCACGAGGCCGATGGACGTCA
CGTCCTCGCCGTGTACTCGTCTCGCCGAAGGCTTGACGCGCTTCGTGACGGAGATCTCGAAGTAGCCGCTGGACACGACACCCACGTGGTACTCGAGCGC
ATTCGTCTGCGGGTTCCTGCGCTTGAACACTGCGACGTGGAACGTCGTGGGGAACGGCGCATTGGACCGCACGCAGCGGTCGTCGCCCAGGATGTCGCCG
TCAAAGCCAAAGTCCACCACCTCCGTCGGCTTGATTGGTTGCGCGTGAAGGGACACGACACTGCAACTCGAAGCCAAGAGAAACAGCAATCGTCAGTTAC
TCTGTCCAGAACCAATCTGATCCACTGCAAATGCACATTGACAGCCATCCACTCACTTCTGCTCGA