Description :
From Genome Similarity Track
Location :
scaffold_140:51104- 57171
Transcript NameFunction/comments
g4464.t1hypothetical protein
g4465.t1hypothetical protein
g4466.t1 hypothetical protein PHYSODRAFT_476816

Sequence
6067 bases(100 bases per row)
TCTAAAGCTCACACGGGTAAATAGTTGTCAATCTTGCTGCTCAATGCCAAATCATAACTAATTATGTTCTTCACAGCATTTTCGCGGGACTAAGGTGCTA
GCTTCTACTGCAGTAAAAGTCTGGAAGCCTCTCGTTATTCCGGTAAGTCATTTCTTGGATAACTCTACCGTGTTTTTTTCTAAGCTTGTCCACAGCTCTT
CTTCCTGTTTACAGGCTGTATTATTGCTGGCGCTATGTTTTACGAAATTGAACGTGGCAAAGAGTGCTTCGTTGGAGAGGAATGTTGGTGGTGGAATAAG
GATGTATTGACACCAGAACTGGCGGCTGGACTCCCAGTCGGAAAGCGAGTCTTGATCCAAGATAAAGTAAAATCGATAATTACCGACATGATACACTCGA
CATGGCTCTCATACACGACGTAAGTACTTTGTGTTTCTTCCAATCTACGCTTGAGCTCACTTTTTACCTTGAATAGGCTCACATCGGTTGGCTACGGCGA
TTTAACAGCGAGAACTTCGATCGGGAAGTTCTTCGATGTCTTCGTGATTATTGTCGCTACAACTTACTCCGCGATGCCTCTATCGCTAGTGGGGACACAA
TTCTACTCACTGTACGAGAAACACATGGAAAAGATGGTCGTGAAGCAGGTAAAGTGCCGACGCCTAATTGGAACTTTCGGTACACTTTAACTTAAACTTC
AACGTCTACTGTGTGGACTTTATAGGGCGGATCATCAGTTTCTTGGCGTACCAAGACTACAATCACCGTCTTGACGCAATATAAGCAGTCAGCCAAGCAC
CCGTCAGCTCGGAAGCAGGATGTTTTTGCGCTCTCGGACGAGCACTTGATAATCACCCGCGAGTTTGAGAACATGAGACGTACAATCCTCAACCTGCAAC
GCACTTTAGAAGCTGCGTCTACCAGTTCTTTCGATGCCGCACAGCGGAAATCCTCTGTGGCGAAAGGTTCAAAAGCTTCAACTACATCCAGGCGCTCAAT
GACAGCAACAGTGAAAAATCCTGCACGTGTTGACGCGTCTATCGAGCAGAAGAGTTTCGCCATTATGGTACGACCCAGAAGTTGTTTATCTTACTTTTTG
ACATTTTCTCTAACTTCCAAAACGTAGGATACGCTGCTCCACTTCTCCGAGGTGGTCGAAAAGTTGCAGGAAGCGCCAGTGGATTTTGAGGCATTCGAGG
ACTTCGAAAACGATCTACACGCCAACATTTTCCCAAACACACACTCTCCACGCCCCACGACCGATATCCAAGACTCGGAACGCCCGGACACGTTCCGATA
ATTCTCTCCAAAAAGAAAAAAAATAAGAAAAGAAAATCCTGGTTCTTGGATATTATTATCCGCCGTAGTAGAAAAGTGCTTTTGTCAAATAACGCACATA
CAAACTTCAAGTGGTTTTCCGTAAAATATTCCAGTTTCGTAAGCATTCAGCACTGTGGACAGGCGGCAACCGAACGACTAAAGTCTTGGCGTTCCGCCGT
TTATAGAGTCTTCAACCTGGAAAAGATCACGAGCTCCTGCTCATTCCCCAACTGCCGGTCTCCATGGAATACGGACGTCTCGTTGTGCTCGGCTACAGTA
GCTACCAGGTGGACATGGTGCGCCGTCCGCGCTCCGGGAGCTTGGAACTGCACATGGCGCCGCCGTCTTTCGGCCTTGCAGACGCTGGAGACGAAGACGC
CGCCCTTGTGAGTCGCAAACGGTCGCTCGGGCAGCTCTGGAAGCCTCTGGGCGACCAGAACGCCCACTATGTACTGGAGAAGCGGTCCAGAGCCAACGGA
GTGAAACTGCAGTGTTTCCACCACATTATTCCAGTCGAAATGTTCCAGGACAGCAAGCACAAGGCAGCGACCAAGGACTTGAAGGGGATTGCCACCCGCA
TTATGCAACGCATTGAAGCGACACGGAGCCGTCCGAGCGTTGATAACCAGAGCGAGGAAGCTCCTTCTCCTGCTATTGCGCCGTACCAAATGAGCATTCC
GATGAACGACAAGGACCCATTTGTGAGTGTTACAGAGTTCCATGCCGACCCAAATGCTGATATGTTCCAGATTGGACGAATGCCTTGTCGTCAGAATGAT
TTTGTGATCCCCGGACCAAGAGTGGGGGCCTCCGGGACTATTTCCCGTTATGCGGCGAGAATTGTGTGCTCTCGAGAGCCTCCTTTTGAGTGTCGGATCC
TTGCTGGGGGCTTTGATGCTGCTCGACGTATGACTACAGCTGGGCATGCGCTGAAATACTGTTCGCGATGTGGAACGTGGTCGAAACGGGTGGGGACAGA
GCACACGTGTGTGATGAAGACTCTGATGGAACAGGCCAGAGAGGAAGGGGACCGAGGCTACTTTAATCGCGCTAAAAGGAGCGACAGAGCAGTGAAGCAC
TACATTGACGAAACGAGCGAAGACGGACCGCTGGAGCACTTCGAAATTGATGTACAAGACGCACAGGAACTGCCGCTGGATGGACTGACCAAGAACGGCG
TGAGGGTGTGGCTTCCAGAGCACAAACAGTGGTTTGAAGTGTCGGTTAATGGGAGACTGTACGCGATTGAGTCCCGCACTGCAGATACCTCTACGAAGGC
TCCACCTAGCTCAAGTTCTGACCGTCGACGTCATCACGAACGCGCAGTGCGATCGCGTAGTGGCGCATTCAATCGACCAGCCAAAGGGGCGCAGGATTTA
GCTCCGATATTGACAGACGGCGCCGTGATCGACCTGGGCGGCGTTCAACTACAATTCCAAACCAGTTACCGCTCGGAACTCGAGGCAAAAGCTGAAAACA
GCGAACTGTTGGAAGCGCCTGTGGTCTACGGCCGGGCGACGCTGTCGTCCATCAGCACACAGCTCGAGCGCCTTAACGTCCAGTGTCCAGTTCAGTTGCA
CTCGTTGCGATTCACGCGCGCCGATCTGGGCGAAGATGTCCCGCTGGACCAGATCCCCCACGTCTTCCCGGCTTGCGGCCATGTTTTCGGATACGAGAAG
CGGATTGCCAGCTCGCACACGTGTCCGCTCTGCAGGACGCCAGGGTCGCTGGTGCAGCTGCTGCTGAAAGAAAACTCGCAGTTGCAGTCCGCTGAAGAAC
AACACGCGATACCAGAGTGCGTGTTTAACCCGTGCGGCCATGCCATCAGTACCAAACTGGCTCGTCACTATTCGTCACTGCTCATGCCCAACGGTAGAGC
CATTTGCCCGTTTTGCGCCGTTCACCTGGATCTGCAAGTGCCATTCTCGAGACTCTACTTGTACTGCGACTCCGACTGACAGAGCTACATGACCGACGTC
AAGATATCAAAGTCAAGTGTGCCAGTGCGAATTTTATACCGTCTACAAGAAATAGACAACCGTATTTGGCAGCACAAAATGAACATGGTGAAACAAATAC
AAAGCTGAATGACCTTTACATTACGATGTAAGTACACACACGATACAATCATACGTCTGTAATTCAGCTCAGTGAGGTTGTGGCACAAACTCGAATCAAT
AGTTATCACAGGTGTTTGTATGTTGTTTCTGGAAAAAAGTGAAATCAACTTATACGTTCATCAAAATATCAAAATAAAGGTGCACTACAGTACTGTAGCC
ATAGACCAGTGGTGGTGTTCACAGACACGTTGTGCTGTTCGAGAGATGCGATGCGTGGTACGGGAAGCCAGAGACCATCGGGCCACTACCGCCCCCCGTT
GACTTTAGGTTCATCCCCATTCGAGAGTCAATGCGCTTGATTCCGCTCTTCCTGGTCGCATTCCGAGCTGTAGAGGCCGTCACGATGGAAGCTGTGGAGA
TTTTCTCGCGTGTCAACTGCGCCGGTACACCCGACATCTTGGCCATATACAACGTGAGCTCCAGCTGCGTTGAAGACACGTGCAGCGACATCAACTTCGG
CAACGCAACGTACTACATGAGTCGGAATTGCAACGTGTCGGACCGGTTTGCGCATACCGAAGAGGTTTTCGGAGACTTTACGTACGTGATCATGGAGACG
TACGACAACGACAGCTGCAATTCGTTCGGAGAGGCCGACGTCTTCCTGGCGTCCGGGAGCTGCGAGGTCTCGTCCGGGTTCGGAGATCAGTCGGTAATTA
CCAGTTTATTCTCCAATGGTTCAGCCGTAGTGGCGCTGTATCCGAACGACGCGTGTGGCGGTGAACCTTCGCTGTACTTCGAGCTGGACCAGACGACGTT
GGCCACGGGCTCTTGTCAGCAAAGTCGCTATAGATTTTACAGCAGTGAAAGCAGTTCGGGGTCGAACAGCGGTAGTACCGAGTCGGACGGGTCCAGTTTA
GGTGTTGGTGCGATTGTCGGTATTGCAGTGGGGGCTTTAGCGGTGGTCATTGCCGTTGTTTTGTGTCTCCGTTGCCGGAAGAAACGTGATACTGAAGCGA
GTCTGATTCTTTTGGAGAGCAACGACAGCTTCAGTCACTTGAAAATACCTCAAGGTATCAAGAACGAGTCGTTGACAGATCCAGGATCACTTGAATCAAC
TTATGACAACAGCGGATCAAGGAAACCTGCAGGTCTCGTGGGTTTATGGGACGACGAAGTGATCGCCACAGCTCGGATTCCTCGAGAGAAAGTGGTGATT
GAAGAAATGATCAGTCGTGGAGGAGGAGGAGAAGTGTACTTGGGACTTTTCAACCAGCAGCAGGTCGCAGTCAAGATGCTGCTCCCGGAAATACGCAAGA
GCGTCAAACACGTGAACGCTTTCTTAGCTGAAGTGAAGCTAATGGCGACGTTGGATCACCCTCGGATCGTGCAGTTTGTGGGTGTGGCTTGGGATTCTCT
CACGGATTTGTGCGTCGTCTCGGAACTCATGGAGGGCGGAGACTTGAGGGCGCTGTTGGTAAAATACGAACAGGAGAACCACCCTACGGGTTTTGACAAA
ACCAAGGTCACTATTGCCTTGCATGTGGCTCATGCTCTCACATATCTCCACTCGCTCGAGACTCCAGTGCTTCATCGGGATCTCAAGTCCAAGAACGTTC
TGCTTACTTCTGCTCTTGAAGCGAAACTTACCGACTTTGGCATTTCTCGAGAGCAGGCGGACAAGACAATGACGTCGGGGGTCGGAACGTTACTGTGGAT
GGCGCCTGAGGTGATGTTGGGTGAAAGATACGACGATAAGGCCGATATGTTCTCGTTCGGCGTGTTATTGTCCGAGTTAGACGTGCACGTGCTCCCGTAC
TCGCACGCAAAAGAGAAAAGCGACTCGGGCCGTAAAATACCAGAGTCGGTTGTGTTGCAAATGGTGGCGCTGGGAAAATTACGCGTTGAATTCTCGTCGA
GCTCATTAGAATCAGTTCTCGATTTGGGTTTGGCGTGTGTGTCACCGGACCCGCAAGAGCGACCAACTGCAGCTCAAGCGCTCTATCGCTTGCACTCGAT
CCTATCGCAGGACCTGTAACAACAAAATGCAAACTACTTCATATAAATTCTTCTTCTTTTTCAATTGTAAGTAACTTACTTCCCCCGGTACTTCGGCGGG
CTGGTGAAGGACGCGTTCGTACGTTTGGGCTCTTTGATTGAGTTGTTGATCGTAGCAGATGGAGCGCCAATGGCGTGGTTTAAACGCCTCATCCCTTTCA
GTGTGCGTACTTTGAGCTCATCTCGAGTAAGAGGGTGCATCGTGTCTTCATTGTCGCCACTATCTTCATCCTCAGACGAGTAATCGTCGAGGTTGGGCGG
ATTAATCTGCAGCGGTTCCTGGCCCATTGGGGTAATCGGCCCGACTCCCAGAATCGAGTGCAGCGTCGCTACAGCCCCATTCATTCCACCTGCAGCTCCA
ACTGCCGAGTTCCCAGCCATCGCATTGGCTGCGAACTGCGACTCCCGGTCATAAGTATCACTGGTGTTTTTGTTCTTTTGCGCGTCCGCTTGCTGCTTGG
CGACGACTGCAGCGTACAGGTGAAGGATCTCGTTGGTCTTCTGCTCGATGACACCCAAGTACGCCATCATGTTGGCTTCCGTGACCACCGAGTCGCCCAA
CATCTCCACCATCGCTTGAGCATTGCAGCCAGTCTTGGTGAACAAGCTTTGGATCGCACGTTTGACT