Description :
From Genome Similarity Track
Location :
contig_19:51100- 52566
Transcript NameFunction/comments
g5375.t1POM65411.1 Hypothetical protein PHPALM_18879 [Phytophthora palmivora var. palmivora

Sequence
1466 bases(100 bases per row)
TCTATAGAAGCCTTTTGATAATATAAAAGACGCGACTTGATGTCGTTCATCTGTCTGGGTGGCGTTGCTTCTGGTTGATCTCGTGGTTTGAAGTTTGATA
GGTAGCTGTGCATCGGGTCTGTTGTTGTGCTGGGTTGTTGTAGGTCAAATTGTCGAGTCTTGTGGGTTTGTGTCAGTGTCCGAACTGCTTCCAGGTCGGC
TTTTGCTGGTGTGCTCCATTGCACAACGAAGAAGCGCTGTAGCTCTTGATCCAGTTCCTGGATGAGGCTGTCGCTCTGTGTTGTCGCTGGTTTTGCACTG
AGGGACTTCTGGATTGTTTTATCCACACTGTCACTTCGGAGGTACGTCTTTGCTGCGTCTCCGAGCTTCTATAGTAGTGGTGAATGGATACAAGAATACC
ATTATACATATCAAAATGCTACAGGCTTGGCGCCTCGAAGCTCTATGTGCTGGAGCCCCACGCATGGTGATCAGCATTGCCTCGCACTGCAATTGTACTA
TAATTTGTAGTGGGGGGTAGAATCTACCTCAGTCGAAAATCGGCTCGTCGCTCCACTCGCCCTCGGACCACCACACTTCCGTGTCTGAATTCGCGTCCGA
CGCAGCATATCGCCGCCACTCCGTACCGTCGTAGTCCTCCACCAGGCCGTACTCATCGTAGCCGTCGCTCTCGTCCACAGGACTCGCGCTAAACGACCCT
GCAGACTTGACGGATCCGCTGGATGCGCTCGCGCCATCGGAATCGTAGATAGCGAACCACTGCAACTGCCGCTGCACAATGTCCACGTTGCCCGCACACT
CCTGCAGCATTTCGTCCACAACGCCGTCGTAGGCAAACGGCTCCTGCCCGAAGTTCACGTGGATGGCGTCCGACGAGTCCAGCCCGACGGCCGGATACCA
CTGCTCATGCACGCACTCCATGGCGCTGCCTTCGTTGCCAATGAGCTCGCCATTGTTCGTGAACATGACAAAGGAGCGGCCATCGCGCACGCTTCGCCGC
ACGCCGCAGCCGATGGTATCGCTGGTCCCGAAGGCTGGGCCGAATTGTCGCCCGCGGTTTGAGTGGAACATCTGACCGTCGTCGCCATGGTATCCGTAGG
ACCGGAAGTCCCAGCCAGGCTGTCGGTCGACGAGCGGAAAGCGCGAGGTCACGAGGCCGATGGACGTCACGTCCTCGCCGTGTACTCGTCTCGCCGAAGG
CTTGACGCGCTTCGTGACGGAGATCTCGAAGTAGCCGCTGGACACGACACCCACGTGGTACTCGAGCGCATTCGTCTGCGGGTTCCTGCGCTTGAACACT
GCGACGTGGAACGTCGTGGGGAACGGCGCATTGGACCGCACGCAGCGGTCGTCGCCCAGGATGTCGCCGTCAAAGCCAAAGTCCACCACCTCCGTCGGCT
TGATTGGTTGCGCGTGAAGGGACACGACACTGCAACTCGAAGCCAAGAGAAACAGCAATCGTCAGT