Description :
From Genome Similarity Track
Location :
Scaffold_1484:511- 4333
Transcript NameFunction/comments
Phyta_totarag13096hypothetical protein

Sequence
3822 bases(100 bases per row)
CGCCGATGATTACGCAGGAGAACATGCGGAAGACGAACAGGTGTACATTAAAGAAGGAGGTGAGCTCTACGCAGAAGACCTCGAGGGTCATATGGCAGTA
TTACCGGAGAtcacgtcgacgacggaAGAAGTCACGATCGAAGATATCCAAGTGGGAAACCCTGAGGACAGCACGCcggaagagatcgagcgaCTAGTAA
AGATCATTTGGTGTCGCCGACACCTTCTAATTGGGAAGGGGGACGCCTTGCCACCTGCTGCGAAGGGAGCGATCTGTGACGTTGATGTGGGAAATTCCAG
ACCGATAGTCCAACGGGTCCGCAAGGTCGCTCCGTAATTCCGCGAAAAGTTGTTCATGCTGATCAAGGGGCTACTGTCAGCCGAGATCATCCGAcactcg
acgtcgccatgGGCGTCCCCGATCGTCGTGACCATCAAGAAGAGCGGAGTCGACATCAGACTCTGTATCGACTATCGTCTGATCAACGGCCTGACCCAAC
TAATGGTGTACCCTTTGCCTCTTATCAACGATCTACTCGACGATCTTGACAAGATCCTCTGGTATTGCTCGCTGCACCTGACTAGCGGGTTTTGGGTGGT
CTCTATGACTGATAGAGCGCGCGCGATCTCGGCGTTTATTACCCCATTCGGGCTATTCGAATGGAATCGAATGCCGTTTGGACTGAAGAACGCGCCGCAG
ATCTACCAGAGGTTGGTGGACAACGCGCTGTATGGGTTCCTCAAGATCACGAGCGAGTGGCCAAGATCACGCCAACCAGACCGACGTATTCGACGAGGGA
GTGCCTGAGGAGGGAAAGGAATCGTCGGTGCTAGGTCGTCGATCTTATATCGACGACATCCTCGTGACGGCAGATTCGTGGGATACGTTGTGTGGaaagg
tggagaagctgctagGTGCCTGTGATGAGTGGAACCTGTCGATCAGTGTCGCCAAGAGCTTCTGGGGCCTACGCAAAGTTGACTATCTGGGCCATCAGGT
GTCCGCGGACGGACTGGAAGCTCACCCGAAGGacttgctgtcgctgacCGGTCTGCCATNAGATCGCTACAGCACCAatcttgcagcacttcgatcCAGA
TCGAAGACCGGTGTTGGTGGTATATGCGAGCAAGTGGGCAATTGCGGCCGCGTTGATGCAAGAACATGGGGGCGTACATAAACCGGTGACGTTTACTAGC
CGGACGCTCAAGCCTAATGATATCGACTACGGAATCGTCGATAAGGAAGTTCTCGCGCTGCCCCGGATCTTGGATGTCTGCTACACGCAGCTAATGACGA
GATCGGTCAAAGTGCTGACTCGGCACTCCATGTTGGCATGGCTAGTGCACTCATCAGGATTGCAAGGACGACTCGGTCGCTGGGCCGCGTTGTTGTTGAG
CTGGACcctggagatcgtcaagtGCGACAAAAGTGAGGACGCGATCCTGGGTGTAATGGCTGCGAGCATCCAGGAAACAGCCCCGGCAGGTAATTACCAG
GCTGTCACCTACGGTGGAGGCGGATGAAAAGTTGCTAGTGGTCAGCTTCGATGGATCAGCTCGAGTTAagcgaggtggaggagcgTATGGCGCCATTGTG
TGGAGCTTATCCAAATGGAAAGTGatctcagcagcgtcgcagTACAAGGACGATTTGGCAGTCAGCGAGGCGGAGTATCATGGTTTGCTCCTATGCTTCG
ATCTTCTGGTCGACCTGGACAGGGACAGCTAATTATCTGCGGAGATTCGAATTTGGTCATCCGACAGATGCGAGGCGAGATCGAGTGCAAGGCACCTGGG
TTAAAATTACTACGCCAACAAGCGATGGAACGCTTGAGATCGTGGCCAAACCGCGATTTCCTTCATGGGAAGCGAGACTGGAACCAAAGCGCAGATCGAC
TCGCCGGTGCCGCTCTTCAGCGTGAAGGAGGCACGGTAGTGACATCAGAGGAGGAGTTCCAAGACCTAATGACGCTTAACCGTCTTGACGAGATGCTAAT
CCCACGATCTGACAGTTCGGTGACAAAAATCACGGCCGTGACGAGATCGCGCAAGTGGCGCAGCCCAGAAGTGTTGCAGGAGAAGATTGTTCAGCGAATG
AGGGAAGATCGAATATGCATGGCACAGGAGGAAGAAAAGTGGATCGTCGATCTCAAGCAGTATCTGCGTGGGGACGTACAAGAACTTACCTCATTAGAGG
CGAAGACATGCGATAAGATCGCTGAAGATTATGAGATCGATGAGACCGGCTTGTTGTTTTACTGCCCGCCGTCCAAGCAACCGAATGAAGATCGCGATCT
CGTTGCTCGACTGGTGATTCCTGagacgctgcaagaagactTCCTACATCATTACCATGTCAGTCTGGAAGGTGGACATCAAGGAATCGGGAGGACGTAC
CATCGGATCAAGGCACATTTCCATTGGAGAGGACTGTACCAGAGTGTGCAACGTTACGTGGGTCAGTGCATAGACTGCGAGACTGGAAAAGGGAGACCAA
CTGTTCGAGGTGCGTCGCCGGACAACCTACAAGCGACGTACCCATTTCAGACCATCGCTATGGACCACATCCCGTCGCTGCCCCGATCTTATAAGGGCAA
CACGGAATTGTTGATCTAGGTCGATCTCTTCACCGGCTTCGTGATCGCTAAGGCAAGTGCATCGAGAACAGCTCAAACTATCGCGGATAATTACGAAGAG
TGCGTCTTCCGACGATTTGGTGCAAGCGAAGCAATCCGGCACGATCGAGAGCCAGGCTTCATGTCGGACTTTTTCAGATCGTTCAACAAGATCATCggac
aacgacaacgagcgACTATGGCGCATCGGCCGCAAGCGAACGGTACGGCTGAACGGATGGTGCAGACGCTAACGCGAGCACTGAAGATGTACGTCGCAGA
CGTCGATCAGAAGGATTGGGACGAGTATGCAGAGCGCCTCACTTTTTCTCGCAACACGGCTCACGATCGAGTGTGCGGCGATACGCCTTTCTATTTGGCG
CATGGATGGGACCCAAGATCAACGCTGGAAGCGATGATCCCGTTAGGATCGACGCGGCGCCGAGATCGCGACCCTCGAAGGCGACGATACCATATCCAGA
AGCATTACGAACAGGCGCGTGAGCAACTGAACGAGTACCTGCGTGAAACCATCCAGTCCAGGGCTGCTCGCCATAACGATTCCGTGCGTCCGCACGAGAT
CGAAGTCGGCAGCCAGGTTTGGTTATACCTGGACAGGGTGAAGGAGGGCTACGCACGGAAGCTAGCGCACACGTGGCACGGGCCATTCAGAGTGATCGAG
AAGACCGACGAACACGGCGTGCGACTGGAGACCGCGGGCACTACGTACAACCGCTTTCCCGTGATCCACGTGTCGAAGCTTAAGCCCGTGCGAGACTTCC
CGGACCGTCCGCGTCTTCGGCTAGctgtccaagatcaagatcgattCGATTTTGATGAAGCCTTGCTGCCTGATGATAGCTGGGAAACGGAgcttgatga
tgacgacTACGAGGTCGAACGCATCACCGAAATGCGATCTGGACGGCGAACACGCTACGGACGAGCACTACGAGAATTTCTGGTGCACTGGAAAGGCTAC
CCTGAACCAACATGGGTGGATGAAGCCGATCCCAACTATGGAGCTGTATTGCACGACTATCTGCGTGAGCAAGCCAACCGGAACCGGTTTGAGGTCATGC
AGTCGCACGAGGAGCAGTAAGGTGGCAAGATCATGGGGTGAGCTGGTCACTCTATGACGTGGTTGGGTGACGGATCTGCGAGGAGGTCGCAGATCAGGAG
GAACGGCTAGATCGTGAATTGA