Description :
From Genome Similarity Track
Location :
Scaffold_1843:511- 2060
Sequence
1549 bases(100 bases per row)
CTCCTATGGATCGACCAGCACTCAGGTTACGTGATCGCGTCGGCCAACCCGAACCGTGAAGCCCAGACCGTCGCCGAATCGTACGAACGCTGTGTGTTCC
GTCGTTTTGGTGCTAGTGAGGTGATCCGGCATGATCGTGAGCCAAGCTTCATGTCTGAGGTATTCAAGGCATTCAACCGGCTGATCGGGCAACAGAGTCG
AGCGACTCTAGCCTATCGACCTCAAGCCAACGGTATAACCGAGCGCATGGTGGGTACGATCACCCGAGCCATCAAGATGTACGTCCAGGACAAGGATCAG
AAGGACTGGGACGAGTATGCCGAGCGACTAGTGTTTGCACTGAACACCGCGTATGACCGGACGAGGGAAGAGACACCACACTACCTTGTGCACGGCTGGG
ACCCCCGGACCACGCTCGAGGTGGCCACGCCAAAGGCGGATCCAGGGATCTCGGCCACCAACCCGAAGGTCTGGCGCAACATGGTGCAACGCGACTATAC
GTACGCTCGTGCAGCCGCCAACCATCTGCTGGAAGCGGCGATGCAGGATCGGGCCGATGTGGCCAACGGGATCGCGACCGGAGGTGACGAGATCGTGGTT
GGATCCCAAGTGTGGTTGTTCTTCAACCGCACCAAGCCTGGTTACGCACGGAAGCTTGCCCACCTGTGGCACGGACCGTTCAGGGTGGCGGATCGTCTCG
GACACTACCTGCTACGACTCGAGATCCAAGGCTCTGAATACCAGTTCTTCCCAGTTGTCCATATAAACCGAGTGAAGGCACGACGCACCTACCCGGAGCG
TCCCGACACCGAGCTCGTGACGGAAGGTGAGCGTTTCGACTTCGACGAGGCTCTCCTGCCTGAGGACAGTTGGGATCCACAAGAGGAGACCGGCGAATAT
GAGGTGGAAGCGGTCTTGGATCAACGGTATGAGAAGCGGACTCGGCACGGACGCAGGATCCGCGAGTATCTGGTCCGGTGGAAGGGTAACTACCCGCTGG
ACTGGATCGCTGAGGACAGTCTCAACTGCGGCGGGCTGGTCTACGAGTTCGAGCAACGGCGGAAGGCTCAGGGGCGTCTGCACGCTGTCGACGCCGAAGA
AAATGAGGCAGGATCCCCATAGATCTCACCCAATCAGCGGCGGTTCGGAGTGCGAGTGACGATGTGGCACACCGGACCGATTTGCGGTTGGGGTCTGGAG
GGACGATGGTGTGAAGGATGAGATGAGCGAGAGTGACGAGTGGATCGGCCCGGAAATGAGTCCGAGAGGCGGCATGGTGACGGATCAAGTGATGAACGGT
GGTGAAGTGATTAGTCGATGGATCGGAGGTGTTCGCGGCGGAATCAAGTGGGGAATTGGCAGGAGACGTGATCGCTCATGGACTGGAGGTACCAGCCGTA
ACGGAGGAACGCGTCATGGCGAGGGCAGAGAGCAACCGAGCGGCAGTTGTGCGATCGGCAGCAAGATCGCGAATGGCGATACGATTCCTGTGGCTGAACG
AACCTTGTCTTCATTCATCCACATGAAGGGGCGGCTGTGGTAAAGCGTA