Description :
From Genome Similarity Track
Location :
Scaffold_5:510964- 512090
Transcript NameFunction/comments
Phyci_300184Hypothetical protein

Sequence
1126 bases(100 bases per row)
GCAGCACAGTGCGATGAAGCTGCACGAGGCCGAGTGGTAGCTGACGAACTGCTAGCAAATTTGAACAAGGATACAGAAGCTGGAAGCAGCAACCAGCTTT
TAGCTGCGGTTTTCACCCGTGATGTTCTGGAAAAAGTCTTCGGGTCGGAGCAAACCCTGCACTGGCAGCAACTGTTGCTGAGACTTGAAGAGCTGAGCGA
AGAACTTCACCAGCACCTCACGTTTGTGTCGGCTCGATTACCGCCCGGTGTGGCGCAAATGTTGAACGCATTGTTCGTATCTCTTGACACGGCTGAGGAT
GGTATCGTTCCATTCCACACGTTTCTCGATCGTCTCCAGACCGCAAATTCGGACTTCAGCAACCGTAGATCCTCTGCTGCGTCGTACACCCAAGGCCTTT
GCTCCACGCTGCAGCGCGTATTAAACCGAGTTAGTTACCACTCGCTCACATGGACAGAGGTTCTTACGCTGGGGGCTAATTGTCATCTTCGAGTTCCCGC
TAACGTTGAAGGCCCCGAATCTGACGACGACAGCCCTCCAGTGCTGCTAGCGCGAGTGAAGCTCCTCCTAAGTCGAGTTTATCTCCGACGAGGACAACTC
GAAGAGGCCGTGCGCTATGCTCAAGTGGCAGTAGTAGCTAGAGAAAAAATTAACGCTGACAGCAGCGACTTGGTACAGTTTTACCTAGTAGCGGCCGAAG
CTCAAGCGAGACGTGGTCGCCAGCTCCGAGTTCTTGGTCAACAAGCCCGTCGAGATCGCGCCGAACGCTGGCTGAAGACGACCGAGGGCTCTCGCCATCT
GCGATCTCGCGCACTGGAAGAAGTGGAACTTGCGAGCGGCAGTGGCGATCCGTTGTTGTCGAAGAAAGAGGCTGAGGCTCGAGCTAGAACGGTTTTGATT
CAGGAACTCACGATCTCGCCTCCGCCATTGACATTGAGCGCTAATCGTCCTGGTAACGACTATGAGGCTTCTGCTCGTTCGTTAATGGATGACGCACTGG
AAAATTGCAGCAAAGCCTGGGCACTCCAGGAGCGGCACTTTGGTCGTGATCATGTCACCACTGCAGCTGTACACGTCAGCTTGGCACAAGTGCATCTCCT
GCGGAGTGGCAACGAGGACCGAACAA