Description :
From Genome Similarity Track
Location :
scaffold_543:5109- 13547
Transcript NameFunction/comments
Pl_103953hypothetical protein PHYSODRAFT_328648
Pl_103954conserved hypothetical protein
Pl_103955hypothetical protein PHYSODRAFT_493974
Pl_103956hypothetical protein PHYSODRAFT_354317
Pl_103957hypothetical protein PHYSODRAFT_488296

Sequence
8438 bases(100 bases per row)
TCTTCAAAATAAGATGGATCCGTTTGGTTACTTTGAGTGGTATAACACAACGTAGGAGATGTCAGAGGAGAACAGACCATCGACACAGCCTCAGTGATGG
CAAATAGTACCGTACCGACTCCAACACTACCGGAAAACACGCCGCTTAGCATCGTTTCATACGTTTTGTAGAGTGCGCCACCCCCATCGTTAACGAAACT
AGGAATCGCAGAAAATATTGTTGAAGCCACCCAGTTCTTAAAGGCAAATTTCTGAGTGGCAATCATCTCCACGGTGGCAACTAGCTCCAGCTCAAGCTCT
TCAGATTTTTTAACCACAGCGTGTTCTGTACTGCAGCAGTCCATGTAGGTGAAAACAAAGTCACTCCATTCGATACCTCCCACCTGAGCAGCCTCATAAA
ACGCCTTCACAACACCATTCGCCGTCTGAAACACTGACGACTCCATCACTGATGTCTTCGAATCTCTGCTATCTTCTTTTGAGGAATGGGAATGTGGTAG
ATTGGTCGAGCTGTTTTTGTTTCGACTCCGAACTATCAGGTCAGCTAACAGCACCACTCCGTCAATCAGCGGCAACAATGGCAATTTCTCTGGTCCGTCT
GTCACTTGTGATGCAGATCCAACCTCTCCCAACCGTAATAATGCGTCTATCTCTGGTAATGAAGAAGGGTAGTCCACCAACAGATACACACGTGCAGGCG
TCTGTGATCCGTTTTCGCATTTAATTTCATTCTCCTCTGCTTGAGACTTCACTTGTCCTTCTTCTGCGTCAACTGAACCTGTCTGTAGATGCGCAAAAAA
CTCTCGTTTGTCCTGACTCACGAGTCGCTGGAAGGCCAACGCCAGCAGTGATGGTGTCACTGTAACTGCTTCTTCCTTTTCTTCATCTACCTCTACTCTT
GCAGCAGCATCTCCTTCTCCAGCTTCCTCCACGCTAGCAGCTCCATCCACGCTAGCAGCTCCATCCACGCTAGCAGCTCCATCCAGTGCCTTCTCCTCAC
GCCGTTTGGTCTCCACCTCCTCCGCGTGCGTCACCCGCACCTGTTCTAACAGCTCCGCCCGACCCACAAAGCGATACGAGCAGCTCCTAGTCGAACTTGC
AAGTGCTGCGTCCCCGCTCAGTCTATTTAGTAGCTCTCTCTTGGCCTCTAGCTCCTTCTCTGCTGTGCCGCTGGTCAGCGCCACTGTGTGGAAGCTCCAG
CAACGCATGGCTCGCGTCTTTTCAAGGTCAAAGGTAGAAGTTGTCCCACATAATCTGTCTCACAATCACTCTGTCTTCATGAGCATATAAAACCCTTGTT
TTTATGTTGAACCGGGGACATTTCGGCCTTGGACAGCTGACACTGCACTCAGACGAAGCCCCAGATGCGACTCGTACATTTCGGCTTTGGACAGCTGACA
CTGCGCTCAGACGAAGCCCCAGATGCGACTCGTGCGTCTGCTGCTCGCTGTGTGCACGCTCGCCGTGGCGATGGCAGCTGGCCCATGTGACGAAAGGAAG
CTGCAGCGAGACGCTGTGATGCTGCTGGCGGCCCACGTGGATGTGGAACTTGGTGGCGTCGGAGCCGGTAAGCGCGACGTCGTCGGATTCCAATATCTGG
TAAGAAATCTCCATAACTTCAACAGCAAATCCTAACATATTTATTGTATTTTGCATCACTAGAAACCTGCAGAAGCTCTACTGGCAGCGCAAGCTCTCGC
TCACGAGGACTTCAGTCAGGCAACAGCGCAGGTCCAGCACATCCTGGAGTATCAGAAGCCCGACGGATTATTGCCTCATTTGGTCTACGGCCCGTCCGTG
CCGTCCAAATTGCGATGGATACCTAGCAATCGAACTTTCCATCCAGGTCCTGCGTTCTGGCAGTCAAAGCATCAGGAAGAGAGTTCGACGTTCTACACCT
CAACAATCTCGGCCCCTCCAGTGGCTGCAGATGTTGCTTGGGAGATCTTCCGCTTGGCACCGTACGACTCAGTGCTTGGTGTGAGGACAACTGCTGTGCA
GTTCCTATGCCGCGTCTACGAGCCACTTAAGAAGCTGCAGAAACACTTATTCTCCACACGCCGCGGTCCCGCTCCCAACAGTTTATTGAGTGCTCGTGTA
AGTTCTAGCTGTTGGTATGTCCCAACACAAGCATTTTCAAGCATGGCTGAAAGTGGTACTAACACATCTTTTCGTGATCGTGGTGTAGCACCCATGGGAG
ACATTTTCGTCATTATCGCCGCACTGGAAAGCTTTTCTCGCCGATCTGAAAAATGCACCAGATTACGAGACAGTTGTTGATTCGATCCCTGAGGAAGCCC
GAATTCGCTTTGCAATCGGAGCTAGCACTATTTTTTCAACTGAAGACGCAGTGGAGAACTTATATGAGCCCATGGTGTATCTTGCAGCACAGATTCACCA
CCCAGGAGACAATGAAATCTCCCATCGCGAATCAACGATGTTAGAGTCCATCACTTACGCTGCGGATGGAGCTGAGTCTGCTCGATTTGGAGTCGAGGAT
GTGGAGTTCAATGCACTAATGCTGCGATCATCGTTGGGACTTGTGAACATTGGTCGAGTGCTCTACGAGCACTCGTCGGTGTGCACAGGGTTCACATTAA
CTCAAAAAGAGCTTCTGAACGATATGGAAGAGCTGCACTCAATGGCCAAAGGGCTGAAAGGGGCTCTCATTGGTACCAACAACTCTCAGGGTTTGTGGAA
CACATCCACCGATTTTTTTGCTGATTCTAGCGGATTGTCCTCGAGTTCAGTTCACTCTTTACGTGGATTTCTACCTGAATACGCTGTAGAACTGGATGAT
GACAAGAAGATGCGATCGATGAAGCATTTCCTTTCGGAACCTGGGACATTCACATTCTTTTGTACGCGGTTCCCGGGTTCCTTTTTCGCATGTACGGGAG
ATGATGATTCGTCTAAAGTTGGCGGTTCGGTGGGTGGCCCCACAGCATCTACGACGTGGATCCTCTACAATTACTTTCTCCAACGAGGGTTTGCTAGGGT
ACGTTTACTTGCTGTTAATAATTGTTGTGATTTGAGATGAAAACCTCGGTGCTAACTCACCGTGAATGATCAGAACAAATTTCCTGGACTGGCCGATTAT
ATCCGCAATAAGACCAGGGATATGATATGCGAGGCAACAGTCACTTCTACTCGATCATCTCTTTCGTGGTTTCCATTCTCACTTATAGCAGAAGAACCCG
CACCTACATCTCTATCACTAGCTTATGATTCTCGTAATGCCGCACCTGTCCAAGTTTTTGACGATAGTTACTTGGGATCAACGCTAGCTGCCGCGGCCCT
CCTTAATATTCTGTTACCAGCAGGTATGTTTATCATACTTGTCTGCAATTGATAATAGCTAACCGGGCCTCCTGTTCTTTGTTTCAACAGTGACCCCACC
ACCAAGCCCAGACACACCACCCATTGACCATCGTATTCTCTCTGTTATCATGTGCATCGAGTTAGTAGTTGCATTCGGAGTCGCCATGAGTTGTTTCCTG
TTTTCAGTGTATTTTGTGGCGAACCGGCCACGAGAAACACGGTTATCTCCTGCATCTGCAGCGCGCCGACGATCATCTGCTGGTGCTGCAGGAAAGAATT
CTCGAGACAAGTTGGATCGTCGCAAAGAGGAGTTGGAGGATCGCGGACGCTCAAGTGCCAGCGGATCATCGTGGGCAGACCGATACTCGGAATCGTCTTA
CAGTGACTACTCACCTCGATCTGGAAACACACCTTATGAGCTGGAGGAGTCGTTGATTTCGGAGGAGGACGAACATTACGGATCATTTGATGAGGCAGAG
CAGCCACAGACTCCGTCCAATCCAGCGTGGAAAGCCGCGAAAAAGGCGCTTGCAACTATTAGTCCCTGGTAATATTTACCCAGTTAAGTTCACTACCACC
AGCAAGAAACCGCCTTAGCCTAATGAACACGATCGTAAGGTGAGTGATCAACGCTACAGCAAGTCCTTTTTCCATTTTGCCACAAGCTGTGTAGCCGACT
TTGCCACGGATGACGTAGAGTGTTTGCGCAGCTTGTTGATAGTGCGTCCGACGCCTGTGCTCTTGAGAATATCAACAGTAAGTACCATGCCCGCGAGCGT
AGTCAACACGTGAGTGGCCAGTGCAGCTGAAACATTCTTCACGTTGCCGTTCTGATCCAGTAAACCTTGCAGGAAGGCAACACGCGTCGCTAAATCTTCA
GTCTCGGACGGGGCGGCTGCAGTTGCTGCTGCCACCTCAGAATCGACATTTGTGTCCTTCGAATCACTTGTACTGTTTAAAGTGCCTCTGGTATCTTCCA
CAGAGCCATCCTATTCCAACAACGTCAGAACCAACAGATCAGAAACTCGGCTAGCAGTTTAACACAGTAAGCAGATTATCACTTACATCAGTAACGCCAA
AATCTGCGTTCAAGTGTAGTTCCAAGATTGGAGTGGCCTCAGGGAAGGCAGGTGCGAATCCCAGTCGGCGAGGCTCACAGAGAGCCCAGAGCGCTTGTAT
AGTTGAGAAATATCGCTGGTTAGGGTCATTTTGTGTTGATTCAGCCACCCAAGACCCATCGTCGCGCTGGGTTAGCAACAAGAAGGCCATCCCTCGGCGC
ATCTGTACGAGATTGCTTGAGCCTTCAAAACATCGCAACGCCTACGCACAATTCTTTAGGTCAGTGAATAATACGACGCGATGAAGTGACGAGCTCATTT
TACCCGCAGAGATTCTCCAAGCAAAGCTACATCTTGCTGCGCCAAATGATAGACGATATGATAGCGCAAAAAGAAGTATTCATGGGGAAGCAGATCCTGT
TGATATGGGCAGGAAAGTGTGAGTAGTTAGTAGTGAACGATCGAAATAATATCGCAGCCAAGCAATGTTGAGTGCCTCACCGTCTCGCAGCGGAGCCTTC
CATGGTTTGTGAGTACAAATACGAGCGTTGTGACCAAGTGCACTTGGTCTTCGTATTCTCGAGGAGAAAGATCACCTGGGCCCTTGTACGGGTACACCGC
CAGCAGATGTTGCAGCAGCTGTGGCAAAGTGAATCCGATCGAGATCCCGAGCGCATGAGAGCGGTGCCACAGAACCAGAGCGCTCGTTAGTCGTTCGTAT
ATCGAGGCTCCATCCTTGTCATCCATAGGTGGAGGTCCTGCTGTAAGGTCCCAACCCAGAAGCTCCTGGATCACAACAGTGTTTAGTTTCCTTCTCTTAT
CATCATCTCCCCGGTGTCTCTCACCTTAGGGCCATAGACAGGAGGTGATCGATCACAAAAGTCCAACAGTTCGACACGCCTCGCATGTGAAATCCCCAGT
CGCTCCACCAAGTAGACGGCAGTAATAGCGTTAACGAGTTGCGTGGGTGTGGGAACAGAGCCGACGGTCCAGTCTGCGTGTCGGTCTTCCTTGAGCCACA
ACGCACCAATGAGTCTGACGTAGAGTGTGGCCAAACGCAGCACTTCTCCCTCCTCCACCGCCTGCAGGTCGTAAAGCGACTGGATGGCGTGCAGACCCCA
GTCTGGGAAGCTCGTGGACTCGCGCAGCATCTGGTACACGCGGTTAAGAGCTTTGACGATACTCTCGCGTCTCATGGCATTCTTCCAGGGTTCTGGAGCA
GCGCGCTTGGCAACTTTCTTAGCTTTAAGTTTGCGCAGCTCCTGGTGCATGAGCCGCTTGAGTACGTCCTTGTGGTTTGTGAGACTCACGTGCACTTCCT
TCTCCACCGCCTGCCGCACCAGTTTCGTGGTCAACTTGGCCACATCATGGGACGCGATCACGCCTGCAATAGCCGCTGCGATCTTGGCCTCCAGCTCCTT
GGAGATTGAGCGCGGGTTCACGATAAGCGACGAGCCCGTGGACGTCATCTTGGTGTACATACCTCCCGCCATCCCGGATTGATCAATAACCGGGTTATTT
CTGTCTGGAACAATAACCTGGTTATATCATTTACCCAATCACCGTCAAGATTACGATTTCCTTACTTTCACCAAGTGAAATTCTGTGTGGCTCTAGACCA
GCTCCCACAACTACAAGATGCTGGCCCGTGCTCTCCGATCGTCTGCGCTGTCGCGCGCCGCGAGCCGTCGCTTCATCGGCGGGTTTGCTGCCGATGCATC
TGCTCCTACCGTGGCGGAGAAAGTGTATGTGAACTCCGTATTAACCTCTTACGACGTCATCTCATGGTATTCTGGTGGTCTAGGGTCAACGTCGTGCTTG
TGGACTACGAAGGCAATCGCCACGTGGTTAAAGGCCGCGCTGGTCAGACGCTGCGTCAGGCCTGCGAGATGAATAATGTGGGCTACGTCAAGGACGACTC
CATGGGCGGTGGCGGCGTGTACAACGCCAAGCGCGCCGACTTTTACACGGAGTCGCTCTTCGGCGAAGGCTCCACGTCTCCGCAGTCGCACGTCGTGGTT
TCCAACGAGTGGATCTCCAAGCTAACGCCTCCTAACAATCAGGAACGCCACATCATCGACACGTACGTCCCGGCGGAGGACCGCTCCGTTAACTCGCGTC
TGGGTACGGAGATTGTGCTGCAGAAGGAGCTGGATGGCCTGGTCGTGGCTGTGCCCGAGGCGCCACCCGTGGAGGAATACAAGTACGAGCACGAGTACGA
CGAGGACGATTACGAGTCGTATGACGACGAGCACCACGCCTAAACAAGAACAACAGGGTGTCTGTAGGAGATGGAACTCACACGTACAGTCAACGCTGGA
CCGGAGACGAGCGAGCGCCCATCGCCATAACTAACAAAAAGAAGAATCCAAGGTAAAAAAGCTGTCGACTCGTGGTATTGGTCTAACCCGCTAGTCCTTG
GGCCTTTTCTTCTGTGCAGCTTTTTTCTTCTCCAACTCGAGTTTCGAGTGGTTTTTGATGTCGCGACGCTTCTTTACAGTGTTGGAGTCGTTGTGAGTAG
TAGAGAACTTCCGTCGTGTCGGTGATCCTTCGTGGTAGTCGCTGTCACTGTGGTCTGTGCTGTTGCCAGCATCATTTCGGTTGTCATAGTCGAAGTCATC
ATTGTCTTCTTCGTGGTTGTCTTCATCAAAATCAGCGTCCACATATGGGTTCATCTGCCGCTTCTCCGTAGGCGATACACGGATGTTGTAACGCAACTTG
TCGTCATCAGTGCGTTTGTCAGATGGCAATCCCGCAGAATCTCCCGGCAGTCCCATGAGATTGACCATCCGAGTGCTGTTTTTGTGGCGAAAGCTGGGGC
TAGGCGCTGCCTGCAATTGAGCTTCGTCACCAAGCACCACCCGCACCACCTTTTCGATTGAGTCTACTAGCTCCAAAGCATTTAGCTGCTGAACGGAGGT
CAGACCCAAAAGCTGGGCGATATGTAGCAGTCCAAGTTGCAGCTTTTCGTGCAAGGATCGCAACCGCGCGGCACGTTCTTTCTTCTTCTGTTTGACCGTA
TTTGTTTCAGCCAACTGCTTCTCGAGCATCTTCACATTGACGATTGCTTTGGAAGTGGCAGCATCATCGTCTCCATTTGCGTTGACTGCTTCATTCTCCA
ACGAGCCATCTACGCCTCCACTAGAGCTTCCGCTAAGTTTAAGATTCACAAACTGAGTCCGAAGCAGCTCCAGTTTCTCGCGGTACTCAAACACACGCTG
CTCTGCATGTTTCTCCTCCTCTTCCAGCTGAACCGAGTGGTCGAGCTGATTTTGCCAACAAAGCAGTGCCTCTTCTGGGTTGTTGATACCAACTTGTCGG
AGAGCGCCCAATATTCCATCATCCTTGTATGCGCTACCCACGTATAACTGAAGATTCTCAGCGTTCTTTTGTCTAACCATCGACGTCTCCTTCATATGGA
TCAGCTTGTCCTTTGCACGGAAAAAATCTGGATCGACAGGAGCTGCTTCGACTTCTTGATCTTTTGTTGGAAAACTGACGTTAGTACGAGTAGCAAAGTT
CTTGCCTGTGCTAGGGTGCATGGAGTTTCTTTTCTGCGGAGATTTCATACCATCTTTTGCCGAGAGGCTAGCGTAGTACAGTCGACGGTCAAGTTCTTGA
CGCCATCTTAGTCGTGACAATGCTTCCTGGTGAATTGAAGCCTTGTCTTGCGTCACCTTCACCAGCTTGGGCACATCAAGACTTGCAAGCCGTTTTTCAT
AAGACACTACCTGTGCCTTCTGTTGTAACTCCACGATTTCGCGCTTCAACTTCGCCACATTTGCCTCAGAAATATCGATTGTATTCGGGTCACGGGCTGG
ATATAACTCGCAGTGACGCAGGATTAACTTGTAATACTCACTACGCTGACGACCAAGGGTAGTTTCGTCATTCACGTTGCGAATGTTCTCGAGCAGGTCG
TCAATGTGCGTGGCGCTCTGACCTACCGCAGACATCTCGGCTTTCGCATCCATCAAACGCGATTCAACCACTTTAAGCGCTTCGTTCTTCTCACGCACGA
CAAATTTTATCCTGTCATACTTCATGCGGAGCTCCATC