Description :
From Genome Similarity Track
Location :
contig_14:510856- 512580
Transcript NameFunction/comments
g3769.t1hypothetical protein
g3770.t1hypothetical protein

Sequence
1724 bases(100 bases per row)
CGACCTCGACGTCGACACCGCCCGCAAGCAGTGGTTCGTCCACGTCGAGCACCACGACTAGCGCTCCCGTGTCCAGCAGCAGCAACACGCAAGAGAGCTC
GGAGTCCAGTGAGACGAGCCCGTCCACCAGCTCCCAATCGAAGAAGGATAGCGATGACGACGATGAGGAAGACCAGACGAGCTCGGACAAGGACGATGAT
GATGACAAGGACGACAGCGACGACTAAGTTGTTCGCTAGGATACTGAGGGCGGCGGCAGTAGTTGAGTCGCTACGTGTATATGTGCATGAGTTCGAGTCG
CGTTATTCGAAGGGAAGAAAAGCAAGGAACAGCGCGTTCCATTTGATGGTGTAGGTGGATACTAGAAATACAACCGCAGTTTGTTTAAGCAAACCCACTG
ACTTCCGTTTCGCTCCACCTCGAAGTTTATCGCTTCCGGCTGTCAATCCACCACAGTTGCAGTTGCACCTGTAGAGTATACCACGACTGTCGCTGTAGAC
TCGTGACAGTGTTGAGTGGAGACCGTAGTGCTATCCTGCAACAGTCCATACGCCTGTCACTGACGAATGCAATTCCTATCTTAAAGTCTTCGTCGAGTCA
TGACGAGCAGACACCCAAGCTGCCTTGACTCAGAGCCCTTGAGCCAGAGGCAAGCTCCGCCCCCACGTTCCGCCGCGGCATCTGCCAGGATTTGAAGCGT
CGAGGCGTCTTGCTCAGCCTCATGATTAGTTGATTAGCTGCGCTTGCCGCAGAGGATATTGGAGGAGTTTCTTCCAGCGCGATCATGTGGATTAACTGCT
TGCTCGATCGACCCCCAAGGCCGATTAATTAGCCGAACAGATTATTATTTAGCGGAGATGCCATCGGAGCGCACAACCTAGCCCAGAAATTAGCCGCTTT
GGAAAGCGAACAACCACGGCGACTGGGCTGAGCCCCATCAGCAGTCTCTTTCGCTAGTTTTCACAGTGGTCTTCACTATGCTACCGTGCTTTCAGTAATC
GACGGGCTTGTCTAGTCTCTGCGTGACGTTGTCGTACGATTCCTCGGGACAAGCTGGGAGGACGAAAGCTCACCTATGTGGCGTGGAGTCACAGCGCGGC
GCCCTGCCTCAATCTCACCCGATCCCCCTGTGTCCTTGCGACGTCGTCCGATTGGGACATCAACACCGCGAACGGAGCGATGCTTGTTCGGCGCCGTCGT
TTCCGGCAAGAGAGCTCTACAGCAGCCCTCTCACTTTCACAATTGCTTTGTGAGCGACACTTCTTCACCTACTTCCGGGCCCAGTTAACACTTGCATCAA
GATGATCAAGGTCTTCGCTATTACCGCCACCATCGCTACTTTCGCTGCTGCCACCGCGTCAGCTGCCTCTGTTCCCGACGGAACGTGGCCCACCAGCCAG
GGTGATGTCTACTACACGGAGCCCTACACGGTCGCGGCTGGAGAGACCTTCGACGGCGGTCTCAAGACGTACCAGCGCTCGGACATCACGTGCGAGGGCC
AGGAGGAGAGCGGTTCGTCCACGGCCGTGTTCCTCGTGGAGGCCGGCGGGACCCTCAAGAATGCCATCATTGGTACCGACCAAATGGAGGGCGTGCACTG
CGACGACTCCGACTGCACCATTGAGAACGTGTGGTGGGACGACGTGTGCGAGGACGCTCTGAGCATCAAGGGCGGCTCGGCATCGAGTGTATCCACGGTC
ACTGGCGGCGGCGCTCGTAACGCC