Description :
From Genome Similarity Track
Location :
Scaffold_709:5108- 8692
Sequence
3584 bases(100 bases per row)
TGTCCGAAGTGCCAGGAGATGCACTGGTTGCGCGAGTGCACTCAAGCCTCTCGGCAGGAGAAAGAAGAGCTGTACAAGAAGATGCGTGATGGTCGTGGGA
ACAAGAAGGCGAAGCTGAAGCGACTTGGCGAATTACTTCCGTCTGCTGAACGTGTGGTGATGTTAAATGGCGTGCTAGAGCTGCCATATTGCCCTGATAG
TGGGTCGGACTACACAGTTATTGGACACTCACACTGGGAGCAATTGAAGGCTCTGGACCCAAGTGTAACGACTGAGGAACTCGAGGTTCCAATCCTAAAC
CAGACATTTGGATCGACGACTGTGACGGCCAAATTGAAGGCCAAGTTGCATCTGATGTTACACACAGCCGCTGGACCCGTTGAGCCAATGAACATGGTGG
ACGTATTGGTGGTTGATATTGACGACGGAGAATTCATAGTGGGAAATGATCTATTAACCTCGCTAGGGATTGACGTCGACCGCCAGCTCGAACAACTAGC
TACGCGCTGTGATGACGAAACCAGTGGTGACCCGATTGATCTGGAGGCAGATGAGATGCCTGTGAACTTGGATGTTTCTGAACCCAGTGGAGATGATGAC
ATTTTTGTCGCTGTGGAGCACCTGATTGATCGCGCATTGCAGAATGGATTTCCTGTGGAGTATGTGGAGCAATTGCGGACGACGGCGCACGCCTACGATA
TTTGGCGACTTGAACTCCGTGATGATTCCCCAGCTAACGTGCCACCGCTGGAAGTACGACTGAAGGATGGGGCTCGTCCTACAAAGTGTAAGCCCCGTAA
ATATCCTCCGCACATCCGAAAGTTTTTACGTGAATTCAATGCTCGTCTTGTGGATTTAGGACTCGTCTACGAGAACCCCAAGAGTCGATGGGCGAGCCCC
GTTCTGCCAGTCAAGAAGTCAGCTGACATTATGGACTTAAGGCAAACAACGGACTATCGAGCAAGGAATGAGCAGACTGAAGTGATGGCAGCTGTGATGC
CGATTCTTTCATTAGTCTTGGAAAATGCACGTGATATGAAGCACTTTGGACTCTTTGACTTCCTTAAAGGTTTTTGGCAGTTGCCACTAGCTGAGCTCTG
TCAAGAATTCATGTCCTACATGACTGATGAAAAGATTTTCACACCTCGTCGTGTACCCCAAGGATGCGCAGATGCAGCGATTCATTTCCAGAAGACGATG
GAGGAGTGTTTCGCAAGTTTGCTGTATGAGCATCTCTTGATCTGGATCGATGATCTCTTGTTGTACGCTGATGACATTGAGGTGTATCTGAAGAAGCTAG
CTGAGCTTTTCTCCTTGATGAATCAATTTGGATTGAAATTAAGCGTCAAGAAATCAAGTCTCTACCAGACAGAAGTAAAATGGTGCGGACGTGTGATCAA
TCACCAAGGTGTTCGACATGATCCAGCACGGATCGACACTTTACGATCGCTGCCGTACCCGACAACTGCTGGGGAGTTACAACAATTCGTTTTTGCGATT
AACTGGATGCGAGAGAGCCTAGTGGATTTTGCTCGGAAGGTCGCGCCGCTCCAACGCCGTCTAGATGAAGCCCTTGCGAGCACAAGGCGTACACGACGCG
CTGCAGCGGGAATTGAGATCAAGTTGAACGAGGAGGAACGGCAAGCTTTCGACCAAGTGAAAGAGTTGTTGGCGACGTCGACAACAATGAATTTTCCCGA
CGATAACGCCACGACGTGCCTATTCACAGACGCATCCGACATTGGATGGGCAGCTATCGTGACCCAAGTGAAGGAATACGACCCGAAGCGGCCAGTCACC
GAGCAGCAACACCGCCTCATCCAGTGCATGAGCGGGACTTTCACTGGCAGCCAGTTGAACTGGACTGTCATCGAAAAGGAAGCCCTGCCAATTGTATTGG
CCTGTGAGAAGATGGACTATTTGCTGCTACGGCCTCAACCATTTCGAATGTTTTGTGATCATAGAAATTTGATCCATGTTTTCGCGCCACACGAAAGTGT
CAAGAAGCACGTGAAAGGCAAGCTTCTCAGGTGGGCGATGAAGCTCATGAATTTCAGGTACATCATCGAGCATGTACCAGGTCCTGACAATGTATGGGCC
GACATGATCTCGCGATGGGCCGGAAATCACACTCCAGTGGCTACAATGAAACGTATTAAAGCTGTACGGCAGCAAACGGCACCAACCAAGGTGAGACTCC
GACCACTGGACGATGAAGATTTCGTTTGGCCAACATTGGAGGAACTTTGTACTGTTCAAGCTCAGTACGAGCGACCGGCAGGGTCGTCAACTGCAGAAGC
CGGAGCGATTACACTAGGAGGGCGCATTTGGGTGCCTTCGGAAGCTTCCGAGTTGATCCAGCGACTATGCATTGTCGCGCATTGTGGAGCCCAAGGCCAC
CGAGGCCAGAAGGCTATGATCACTCACCTCAAGCGACTTTTTGTGATTGACAACGTTGCAGTTATCGTGAAGAAATTCGTGAAAGATTGTTTGCTGTGCC
TGCATTGTCGAGGGGGGAAAATTATCCCACGTCCGTGGGCGAAGTGATCGACTGCAGTACACGCAACCAAGTCTTACATTTTGATTTTCTCTCTATGGGA
CCAAGTTATGGAGATAGCAAATATATCCTGGTTTTGAAGGACCACGCTACTCACTACTGTGAGTTAGTCGTGGCAGACACGGCTGACAGCAGAGTGACGG
TGGAAGCTCTGTTAGCATGGCACTCGAGGTTCGGCATTTCGCCGGAGTGGATGTCGGACCAAGGCACGCACTTCAAGAATGAAGTGGTGGCGGAGTTGAG
CCGCAGACTACGGACGCAGCAGACGTTCACACCAGCATACTGTCCATGGATTAATGGATCAGTCGAGAGAGTTAATCGGGACATTCTTTAAGTCGTCAGG
GCAATGATTATCACGTACAAGATAAGTCAGAAGGATTGGGTATATCTGGTTCCGATGGTGCAGGCAAATCTAAATCACACTGCTGTGCCATCCCTCGGAA
ACCATTCCCCATTGGAGCTTTTCACTGGACTGCAGAACCCAACTCCCTTACGTGAATTTTATCTTTCTGATGGCAACAACTTGCAGACTATTCCTGAATA
TGAGGAGATCGATGGATATCTAGCCGAGCTACGGGGAAGTATCCAGGCCATGCATAGTGCAGTGGAGGACCAGCGATTGAAGCAGCGTCTTTTAAACAAG
AAGCGCGAACGTGGCGAGAATATGGTGAACTTTTCTGTCGGCGATTTCGTTCTTCGTTCTCGAGTTGATGAGAAGCACGGGAATAGACTACAAGTGACGT
GGGTTGGCCCATACCGAGTGATACGCGCTGAAGCTTATTTATTCCGAGTACAGCATTTAGTCACAGGCGACGAAATGGATGTACATGCGTCGAGACTGAA
GATGTATGCGGATGAAAGTTTGGAGGTAACAGACGAGCTGTTAGAACACGTATCATCTCAAGGCATCGTGTTATCTGTCGATAAACTGAAGGGTCATCAG
TGGAACAACGAGATTAAAGATTTCGAGATACAAGTTGGATGGAAGGGCTTACAACCCATCGAGGATTCGTACGAGCCGATGTCG