Description :
From Genome Similarity Track
Location :
Scaffold_12:51079- 77845
Transcript NameFunction/comments
Phymu_g893hypothetical protein
Phymu_g894tryptophan synthase
Phymu_g895hypothetical protein
Phymu_g896DNA repair and recombination protein RAD54
Phymu_g897conserved hypothetical protein
Phymu_g898hypothetical protein PHYSODRAFT_508492
Phymu_g899hypothetical protein
Phymu_g900hypothetical protein
Phymu_g901hypothetical protein PHYSODRAFT_560612
Phymu_g902hypothetical protein PHYSODRAFT_560612
Phymu_g903hypothetical protein PHYSODRAFT_354854
Phymu_g904peptidyl-prolyl cis-trans isomerase, mitochondrial precursor

Sequence
26766 bases(100 bases per row)
GTGTTCAAACAGTAAAAAGCGGACTTGGGCTGTCCGCACTCTGGTGCATGCACGATCGCCATTACCGCACCATCCGACATCGCAGGGGAAGTAGAGAACT
TCCGACCCTGCGAACAGCACGACGGTGGTCTCCTCGTGCACCAACAAATATACATGTAGGCCCCTccctgtacatgtattctcCATTGCTGGCCTCCAGC
CAAACGCGTCCAGAACTACGGCGATTCGCTGAGCGAACCCATGCTTCAGTCCAGAAACTCAAGGTTCTGCTATTGGTGGAAAATGCGCCGCCGTTTCCCG
CAAACCGCCTGCGCTAGAATCAGGGCTGACTCTATCGCACGCGCCACTCACCGATTTGCGTTCCTGGACGGAGTTCAAGCGGTACAACTCAGGTTTCTCT
CGACCCCCCCCTCTTCCTCGACTCTACAGCCAAGATGGTTCGCGTGCTCGCCCTCTCCGCCGCTGCGGCTATGCTGGCGGCCTCTTCGTCGGCTCTGGAC
CAGAAGCTCTACGGACTCAACTACGACTTGCGTCAGGGCCCCGACTGGGACGCCGACAAGTGCAAATCCTCGGACACCATTGCGGCTGACCTTAAGATCC
TTAGCACCATCACGTCCAACGTGCGCACCTACAGCCTCTCGGACTGCGATGTTACGGGCGTGCTcaaggccgccaaggacCTATCGCTCACCGTGTGGCT
CGGTGTCTGGGTGTCGGAGGACTCGAAGGTCTACGACGCCGAGGTCGCGgccttcaagaagctcatcgcCGCCGGCCTCATTGACAGCAATGTCGTCGGA
ATCAACGTTGGCAGTGAGGCCGTGTACCGTGAGGACATCACGGCCGAGCAGGCCATCAAGTACGTGACCGACTTCAAGAAGGTCATGTCGGACAACGACA
TCAGCGTGCCCGTCAGTATCACGGACATCATCGACACGTTCGTCCAGTACCCGGACATGCTCAAGGCCGGTGATATCGTGACCATCAACCAGTTCCCGTT
CTGGGAGAAGATTGAGGCTGACAAGGCCGCGGCTCAGTTCAACAAGCGCATCCAGCCGCTGCTCAAGATGGCCGGCGACATGGAAGTCATCATCAGTGAG
ACTGGTTGGCCCACGGGTGGATCGGCCACGAACGGCTCGGTGGCCTCTGAGGAGAACGGTGCCACCTACTTGAACGATTTCTACGAGCTGGCCGAGTCCA
AGGGCTGGAAGTACTACTACTTCGCGGGCTTTGACACACCCTacaaggaggagcaggcggacGACACCACTACGGTCGAGTCGCACTTCGGCATCTTCGA
CGACAAGGGAACGATGAAGACGGCCTACGAGAGCCTCAAGTTCACCAAGACCGGCGACTTCTCCACTTCGGGAAGCTCGGCCACGACCACCTCGTCGGGA
TCGTCGAGCACTTCGGTCGGCGCTGGCACTGTTGCCCCCGGCAGCGGCACTTCTGGCActaccaccagctccggcacCAGCGACTCTACCAACACTCAGT
CGTCCTCGAGCGCTGATAAGGCCGGTTCCTCCAGCATTTCCAACGCGGAGAACGGATCGTCGCAACTTGTGGCTGCCAGCTTCGCTGCcgttcttggcgt
cgtctcCACCATGTTCTGGAGCCTGTAAGCAGTTTAGTGTTAGCAGGTCAAGGTTTGGTAGCTAATTCATAATAGTTACGGTACTTTGATTAGAAATTAC
GTGCTTACCATCATTTCTATTTCTATCTTTTGGgttcctgtacatgtatactgTATACCGCAGTATATGCAATGGCTAGCTCCCAGGCAAATGAGGCCGC
CACTAGCGATGCTGCAAACGAAgggctgctggtgctggtgatcGACACCAACCCTGTGCATTGGCTCGGTCAGGGCGGGAGTGCGAGTGACCGTGCcggg
ctgcagcagctgatcTCCAGCACGCTAGTGTTCGTGAACTCGTACCTACTACTGCATCGGAGCAACCGCATCGTGATCATTGCCGCCCACGCCGGTACAA
GCGCCATGTTGTATCCGGATCCAGAACAGGAGGACACTACTGGAAGTGCGGAACAAGCAGCCAGAGTGAATGCTGGGGTCTTGCAGCGCCTGCAACAGCT
CAGCGACGCGCCGCTGGACCCCGCCAAGACAAACCCAACAGCTATTGCTGCATCGTTATCTCGTGCACTGTGCTGTAAGTGTGGCGCAACACAAATAGCA
TTATGCTGTGTGTTGATGTTGAcattgttgttgttgttgttgtcgttgtgtGTGCGCTGCAGTTATCAATCGAGCTATCAACGAGGAGTCGGACCTTCGA
CCACGGATCTTAGTTATCCAAAAGTCTCCAGACGTGTCGGAGCACTACATTGCCATCATGAACGGCATCTTCTCGGCCCAGAAGAAAAACGTCGCAGTGG
ACGCATGCATCCTCGCTACGGAACACTCGTCGTTCATGCAACAAGCAGCGTATCTTACTGGCGGGATCTACTACAAGCCCAATGACCACAGCgggctgct
gcagtaccTGATCTCGATCTACCTGCCAAACCCCTCCAtgcggaagctgctcaaaCTACCGTCTCAAGACTCAGTTGACTTCCGTGCAATGTGCTTTTGC
CACCGCGAGGTCATTTCTACAGCTTATGTCTGCCCCGTGTGTCTGTCACTCTTTTGCGAGTTCCGGCCCATCTGTTCCACTTGTGGCATTCGTAGCCACA
tccagcccaagaagaacggtgtaaacaagcgccagcgcgtGGCTTAAATAAACGTTGCCACTACGGCACGAATTACATGTCAACTTGTATCTGCATGTGA
TGTTGCCTTTGGCTCGATTGACGTTACACCTCCACCATCACCTTATCCGATTGGCTGAAACCAATTCCGATAGCAAAATCATGATTATGCGCAGTTTATA
GCGCTATGGTTGGTAGAAAATACTTTGACCAATTACCGAGGCAGACCGACGTCAGCACATGAGCTTGCCATACTCAGAATCTCCACGAAGACAGCAGACC
CCGACACCATGAGCAGGTGGGAGCAGCGTTCGGTCGACTTCGTGTTGGGTTAGCAATTAGCAACGTACTCACCTATTGCCTTGCTTTTGCCATTGCAGAC
CGACTATTGCTGAGGTTATTGCCGAGCGCAAGGCCAACAACACGGCCGCCTTCATCACCTTCGTGCCCTGCGGCTTCAAGACCAAGGCTGACACGGTGGA
TATTCTACTAGGACTGCAGCGTGGCGGTGCTAACATCATCGAGGTGGGAATTCCGTACTCAGACCCGCAGGCCGATGGCCCAACCATCCAGCGTGCCCAC
CAGGTGGGCGTGGACCAGGGCATCACTTTGCATGACGTGCTGGCCACTGTGAGCGAAGCGCGCGCCAAGGGTCTGACCACGCCAGTGGTGCTCATGGGAT
ACTACAACAACATCTTTCAGTACGGCGAGGATAAGATCTGCCCTGACGCGCAGAAAGGTACGAGCCTGTTGCCATTGTTGTGCTGTTGGCAGTGATCTGA
TTGTGAATTGTCTTGATGCTGACAAACTTGCAGCTGGAGTGGACGGATTCATTATTGTGGACTTGCCCCCTGAGGAGGCCAAGCCGCTCAGTGACGATGC
AGCCAAGCACGGCCTCGCTTACATTCCGTTGGTGTCCCCTACGACGACTGAGGACCGCATGAAGCTCATCGACTCGGTGGCGCATGGCTTCGTCTATTGC
GTGAGCCTTACTGGTGTCACGGGAGCTCGTAACGAGCTGCCTCCGAATCTCGATGTGTTCATGGCTAAAAGTAAGTCGTGTATTTCAGAGTATGCTGCGA
ATATTCCTCTAACGCTTTTGGCTTGATTTACTGCAGTTCGTGCCAACGTGAAGCACCCGCTAGCGCTGGGCTTCGGTCTGTCGACTCGTCAGCATTTCGT
GCAGGCCAGTGCGCTCGCAGACGGCGTTGTGATCGGCTCAAAGATTGTCAAGATCATTGAGGACGCCCCCGACACTGCCACACGCGCCGCCAACGTGGAG
GCTTTTGCCAAGAGCATCGTGAATCCTTAGCTCCACTACCTAGGACTACTGAGCTACAGTGGATACTCCAAATATACTATACCGTACGTCAGACTTTTCG
TTAGCGACTTACTAAATTCAAGTTTGTGTGTAGGTCAAATCGTGTGCCAGTAGCCCAGTCGGCAACGGTGGGCGTCTACGACGTAGTTTGGTTGGCGTGA
GTTCGAGTCCCACTTCGGTCAAAAACTCGCAGTTCGTATTTAATAAAGCAGGGGTCCCATACAATTCGTAGCATACTTCGAAGCCCGGTGTGTCTGTACC
ATTAGACTAAGGATCGGGTCAATATGTGTGCAATAGTAAAACCCGCGTGTCAGGGTGTCAGTACTGGGTGATTGGCCAAAAATGGTGAATTAGTCTCAGA
ATCTGCCAATCGACATGCGAATATCTTTTGTCGAAAGGACTCGGattcacttcaactacgGCAGGACAGGACCGATGGCGTCCATCATGGACGCGCTGGA
GGTCTTAAagaacgacggcaacgtgcagtttcagcagcagagatTCGCCAAGGCCGTTGAAATTTACAGCTCGGTGCTCGACAAACTGCACGACTTGGGG
GCTAATGACGAAGTGGCTACTCGACTTGAGGTGGCGGTGCGACTCAACCGAGCATGGGCATGGATCCAGATGCCACACACTGAGTCTACTTTACTAACCG
CAGAGCAAGACTGTAGCACGGTGATTAAGAAGGATCCGTCTTGTGTCAAGGCCTTCTATCGGCGAGCGCTGGCACGTGAGCGCAGAGGGCAATGGAGGGT
AGGCTGTGAATGTATTAGTTAGAAAACGCTCTTTAACTGAGCTTGGATGTTTGCTTGTAGATGGCGATGGATGATGCAGTTACCATGAGGCAGCTCGAGC
CTGGTCACCCTTTAGTTGGCCCGTTGCTGGAGAGACTACAACAGCACGCACTAGAAAAAGAAGACCTGGCGCCGAAATTTCAGCAGTGCTCAGTTAAAAG
TGATAACACCAACATTTCGGAGACAGTTTCGCTTGCTAAGGAGGCAGAAGATGCGTGGAAAGCATTGCAGGCAGTGGAAATTAATCTTCAAAAGTCCAAG
GCACGGCATAGACCTAAGAGAAGGCAGAGTGACAAGAAGGCCACTCGAGATGTCTTGAAAGGGGAAATCTCAGGGAAGACGGACGAATTGTGGGAATCTC
TTAGGCGGGAGGAAATTACAACGCTCAAGAAAGCATATCCGCGGTCGAAGAAAGATGTAAGGTAGCGATAAAGCAGAATAATAAAACGATGGACACAAAC
TCTATTACGCTATTCTTACCggtcttcatcgtcttcgtcgcccAGGTCGATAATTTGAGGGCGAGGTCGTCGGTAGCGGAGGccgcagcttgagcagctg
gCACTACTTGTCGGGTTGATCAACGTGCATCGTGAACATCTCCACGCACCAGCAGGCTCGTCATCTTTGCGTTCTTTATCAACAACCTTTTCACGACTTG
TGCGGTAATTACTGAGAACGTCTTCCACGAAGGCATCCTCACCATCAGAATCTGAAAAATCACTCGTCTTTTGCTTTTTTGATGGTGACCATGAGCCCGC
GTCTACCTCTGGCGCAAATGACACGCTGCGTTTCGACTTAGCGGGTACCGCAGCTGGTGGTTCGGATCGAATCGAAGCTGGGTGAGACGATTCCTCCAGA
GAACTGGTCGACACTACAGGTCGCCGAAGTGGAGGCTTTGGAGTACACGAAATTTCGCCTTCAGAGGCAATGCGAGGTTCGGACAAAAATgcgtcttcgc
cttcgcccTCTGATTCACTTTCGCTCTGGACTTCGTCATGtccgtcgtcctcatccGTGCTTGAACACTCAGCCTCCGATTCATCCGAGTCTTCAATagt
tttgtttttcttcgATTTTGAGCGCTTGGATTTGTTTTCCTTCGCAGCACGCAGTTTTGCAGCCTCAATAATCTCCAAACGCTTACGTTTGCGTTCCTCG
TCACGCTGGTTGTCCTTTTCTTCGTTTTCAGCCTGGTGCTCCTGAAGTAACTCCCAGTCGATACGACAACTAAAAGCAAAGCTCACTAAGTCATTCTGGA
CTTGCTGTAATGCTGATTGCATCACTTCGTCGTCGACAGACGCGTAGGAGCGGTGATGGCCCCAACTATTCAAATCTTCTTCTGGCGGCATGCCAATTTG
CGGGTGATAGCCCTTGTCACTCCCCTTATCAACTCCGGCATCACTTGAGGTATCTCTGTCAGGTGACGTTTCGTTTTCTGTTTCTTTTCCACTGTCATCA
CCGCTATCGATCGCAATACCGGATAGATTGTCTTGAGCTCCATTAGAATTATCCGCATCTCGCCATCGACATCGATCACATTTCAGCTGGTCGTGGGTGT
CCGACATTGTGTCTTTCCGGAACACGAAAAGCCGCTTTAAATCTTTTGAAGACAGCGAGTTCACCTCCTCTTTATCATCAACAATATTTTGAAGGCCCTC
TTTGGAGAGCTGGCGTTGGAAGATTTTCTCTTCGAGAGTTCCCGTCGCCAGGAAACGGTAAACGAAAcacatcttcttctgcccTTCACGCCacacacga
gcagcagcttgcttATCTGTTGCAGGGTTCCAATCAGGATCAAAAAGTACCAACCGGTTCGCTCCAATCAAATTCAAACCGCATCCTCCAGCTTTACTGG
AGAGCAAGAATGCAAACGAGTTCGTTGTCGGGTCATTGAACGTGTCGACAAGCTTCTTTCGTTTCTTTGCAGAAGTCGTCCCGTCAAGACGCACAAATGG
CAAATGCCGTTCATGGCATAAAGTCGACACGACATCCAACGTCTGCGTGTAATTCGATACGATCACGATCCGGTCTGTTGTTGTCTTCCTCATCGAAGCC
ATCAAACGGTCAAGCAGAAGCATTTTTCCTGACCACTCAGGGTAGCAAGTTCGTCCACCGAAGCCGCCTCGTCGATTGCCACCCCCGCCATTACCGGATT
CCTTTGCTGCTGTAAAATACTGCGCACAATTGCCGAATCCTGGTAGCTTGGTGTTAGTTTTCCCCATCTCGTCGAAAATCAGGAGCGGGTGGTTGCACAA
CTTTTTCAGTGCAGTAATAGATGACAAGACGTTCGCGCTCGAACGCTTCATCATATCACggcaggcgctggacgacagGAAATGATTGTAAAGCTGATCC
TGAAGTGGTGACAACGGACAGCAGATCACCTGCATCAGCTTTGGCGGCAGATGCTTCGCGTTCAAAATGTTGCCTCGGCGCAAAATGAACTGATTCACGA
TTTCACAGAGCATTGCTGAGCATGATTGAGCTACTTGACGTTCACGATCAGTTGAGTCAGGTTCTCGTCCAATTAAGATAGGCCCCAGATAATTCTTCCG
AAATTCACTTGGTGTGCCCAGAATGTTGGGGTTGGTAAAGTCTACCATCGCGAAAAACTCTTCCAGGTCGTTTTGCATTGGTGTACCAGAAAGAAGGACG
CGCTTCCGACACGCCAGAGACGACAGAGCCTTGTTAATTTGCGAGTTGGCGTTCTTCAGACGATGCGCTTCATCACAAATAAGCAGTTCGCAGCACTCTG
GCGCGTCAGCAAACTTCTGGGCGTGCATACGGAACGTCTCGTACGAAATGATGAGGACCTGAGCAGAGAATCCTGGGCGCGGTCTCTTGCTTCCATCGAT
AAATTGTTTAATGCCTTTGATCACTGTCTCTCGTTTCGCTTCATACAGTGCCACCGTCTTCACGCGTCCGTGCAACCACTTGATAATTTCATCGTCCCAG
TTCTTCACAAGTGATGTCGGACACACCACAATTGCTCGTTTCACCGTCGGCTGCAGGTCCATGCCTGTCATGAGCAGTGTGTACATCAACGCGATACTCT
GCAGGGTCTTACCAAGACCCATATCATCAGCTAGAATGCATCCTTGTCCATCGAATCCCCTCACTTGGCAGACACAATCGAACATGAACTGCACGCCTTC
ACGTTGGTGAGGTCGCAGGAATTTCCCTACGATCTCAGGCACCACCACTTTAAGCTCAGTATCTGTTTCGCTCTGCCATAGCACTAGTGGCGGCGGAGca
tcagctgcaggagctACAACAGAAGTTAGCTCTTCTGTAACTGCAGGCTCGGGCTCATGGGGCATCTCAATCTCTTCTacatccacttcaacaggCGGAA
GGTCGTGATGCACCATAGGTTTCAACACTAACGATCCCCATCGTCGCCTCATACCAAGGGTCTTGGTCTGCAACAGGCGGTTGCTCTCCTGGGTGcgacc
tccttctccacatGGAGACTTGAATGGACGTCGCACGTGCTGTGCGCGGCGCTCAGGCTCCATGACCAAGAATGACAGGAACGGGAGCCGCTTCACAGAC
AGCGACGCGCCGCTACGTAGTGCCTGGCGATTGTTGACTGCATCCTGATCTTCATACacatcatcgtcttcctgtTGGTGCTGAGTAGGCGCTGCCTTGT
CCTTCACGGGGAGCACAAACGGCTTGAACTGCGCGCCACCGCCGAGACGTCGGCGCAACAtgatggacgagttcaaACTGCGGGAAGAGGCAGCGATGTT
ATTCCGATTGGACAAAAATGAtgaagtgaccatcactcagATGTCTAAATTGAATGCCAATTTGATTGGATATAATGAAAGTGTGATTTAGCACCAATGG
CAACAAAGGCGCAGAGCCAACGGCGCACGATGGCTGGGGCGCAGATGATGGGTCTACAGCGTGCGCTGCGGCATCGAATACAAGGGTCTAAGCGCGTGCT
TACGGTTGCCTTAGGTAGAAGAAACGATACTCTTGTCATTTCCTGTCTCCACACCCGCCAGTTCGCGGTGTTGGCGTCGAATGATGACCAAAGCGCTCGC
CAGACAGCATTGCAGCGACTGACCGATGCTTCTCAGCGATCGTGGAAGCTCCGAGCTATAGCGGAGGATGTGAACAAGTCGATGCCGTTGGGCAGAGGCA
GAAGGTTTTACAACCGTCGAGTggtggaggctgtggagaaTAGCGACATCAATCGAGCTTGGGCAATTgtggagacgctgcatcGACGAAATCCGGACAA
ATCGGTGCTGTGGTCGTACACTTATAACCTGCTCCTACGTCACTGctgcaagcagcagaagacgatAGCGAACGCAAATCTAATGCGTGTTCTGGCGCTT
TTGGACTTCATGGCGGCTCAAGGATGCGCGGACCAGACGAGCTACCAGGTCGCCATGGCTGCGTGCAGTAGGGCACGGCATCTGCCCAGTGCGCGTCATG
TactggagaaaatggaggGAGTTGGCCAGCAACCGGATGCTAGGATCTATGGATTTTTGATCAACTGTTGTGCGAGGAAGCAAGGAAAAGTGGCAATGGC
GGATGAGTATTTCGAGGAGATGCTTTGTGCTGGCCTGAAACCGACTGTGCTGGTGATTAATGCGATGCTGAGAGTGTATTCACGAGACAGTGGACGGTCG
AAGCTGATGTTAGATCTTGTCAAACGCGCGCGCGAGGAATACGGATTGGTTCCCGATGCTGTCACCACCCGAACAATGGTGTATTATCTGCTTTGTGAGA
ATGATGTGGACACAGCAGTGGAGTATTTGCGAGGTGTTGTGAGTGATTTCCCTCTTGATGATACGGTGAAATTACCTGTAAAGCGTCAAGTGGTGAATTC
ATTGATTGATGCTTGTCGTCAGCGAGGAGACTGGGATTCCGCTGACTATGTGCGAACTCTTGTGAAAAGGtccaaagaagaagacagtgTTACTGCGGAT
CGTAAAAAATATGCTAGACACACTGCAGAACTGGACCGGTTGGTTATGCAACGTGatgcttcttctcctgcggTAGCCTGGACATTAAATGAACGAGGTT
TGTCTCGGATGTCGCGATCAGATCAAGAAGCTTTCTTTCGAAGCCGAAGTAAAGAAGAAAGCGTCAAACGTGCCTTGGAGCGAATGGACCAACGTACTTT
AGCATCTAAAGCTGATCGAGCTATTCAAAAGCTATCTCTGAAAGTGGAGGGGAAACTGCGTGTTCTGGACGAAATGATTCAAACCGAGAGTGCGAGCGCA
AGTGATTTTAACGCCGTTTTAAGCGCTTGTGGGCGACAAGGTCGGCTGACAGATGCTGTGGCCGTCCTTGACAAAATGAAAAAGTACGCAGCATCGATGG
TCGAGTGTGCAccgacgacgtggagctATAATGCGTTACTGAATGCGTGTGCGGTCCGAGGTGATATCCATCAAGTTGAGTCAATTGTAAACGAGATGGT
CGACAATGACTTACTTCTTGACCAAGTGACCATGAATACAGTGCTCAAGGCGCACATTACGAACTTAAAGGATGGCTTAAGTGGGAGCTCGCAGGCACGT
CTCACTACGGTGATGCAAGCGCTTTCATTTTATGAATGGTGTATAGAAGACCAAAAGCTTGATACCGGGACGGCGACGTATTATTCACTATTTCGATTGT
TTGTCACTTACATGGAGCTCCCGGATAGTTTCAGTTCCACTCCGGTTGAAGATGACAGTGGAGCGAATTCCGATGAGAAGGATGAACGATATACTgaagg
tcaagaaggcgaactGATGGCATGGATGGCGGAGTTTATTACTACCGCCTGTCGCGATGCTCCACTCGGGTCGCTAGACATTGGAGTGTTCAACAACGCG
TTTGACTTTCATTACCGACTTGGCGACGTTGATGGGTCGTTTGCACTATTTAatttgatgaagaagcgcggTATTCAACCAGACGACACGACTCTCGGAT
TAATGTTTGCGACTTGTGCGAGCCAACAACAGTTTGAAGTGGGCTTAAACTTCTTAGACCATTTAATGACCGCTGAGGGCTACACGCCTACGCTGAAGGT
GCTTAGTGGAGCTATTCAATTGTGTGCAAACTCGAAGAACCCGGATGGAGCGTTGGAACTTTTCCGAGCAATCGAGAAGTCAGGCACGTATACACCCACG
ATAGAAACTTATGAGCCCGTGGTGTTTGCGTACGGACGCGTCGGAAACGTATCCAGTGCGTGGGAAATCGCAAATGAGATGGAGGAAAAGCTTGGGAGGG
TTTCTGTCAGTATCTACAATCGTATTTTGTTGGCAtgcgttgaagcagctctcCCTGGTCGCGCTCTACAAGTTTTGGGGGTGATCAGGAATAAAGAAGG
AGTGAGGGCCGATGTCATTTCATACAACACGGCGTTGGAGGCTTTCGTTAGAGCAGGAGAGCGAGCTGCatggtggaggaagaacaACGCTGGCTGGGAT
GAGGATGATGGTTTTGATgatgatgctgaagatggaCGTGAAGAGGAATATCTTGATGGTGATCTGAAGGAGGACATGGCTAATGTCGACGACTTGAATg
cacttgaagaagttcccgagaaggaggcgcagaTTATCGAGCTTAAGCACCGCGAGAAGGCTGCGTGGGCTCGTGCCAGTATTATCGATCTACTCGAAGA
AATGCAGCGAAGCCGCGTAAAACCTGATATGACAACGTACGAGCGGGCAATTGCTACGTGTAGCGTGAATGAGGACTCGGAAGGCGTTATCACCATATTC
GACAAACTCATTGACCGCAAACGTGAAAATCAAGCGGTTGCTCTGAGAAGTGATCTCATCAGTGAGTCCAGTTTTACAGCTTACCTCGTGGCATGCACGG
CTTTACAAGACAAGGACAGAGTCGTTGAAGCCCCGACACTTCTCAATAAGTGGCACACCGCAACGGGCCAAACTCCACCAGCATTTGTCGTAATGCAGTT
GTTGGGCTCACtagaggagctggacgagtgGCACTGTGCTGTACGGATGCTCCCGAACTGGCAAGAGCTTTTCGGCATTCCGCCCAGCGTTGACGTGTTC
AACAGGGTCATGGAGATGTGCAACCGCGCAGGAGAGCATCAACTTGTCGCTCCAATATTCGCTACTATGCAGGATGCTGCGGCTTACCGCATCTACCCGG
ACGCGGAAAGTTACATTCAACGAATTTACGCCGAGGAACAACGCGAGAACTGGGTTGCAGCCACCGATTTATTCGTCGAAATGCGAAAGAAATGCCCAAG
TGAAGAGATTTCgcaccaacagctccaaaAGATTGCTTTGGGTCGATACAGGTTACGGCAAAATCAGCATTAGAACAAATGTAAAAAGTGTATTCATCAT
TCACACGCAAGTAGTGTTCAGATTCACATCGGATTTTCAAGAAGActttcctcttcgtctcgaagctcggggatcgacgaagacaacgacaaACCGTAGT
TGGGACTGCCAGGGAAGCTGCTTGAGGCAGTGCTGCCACTGGTGTAACCTTCtccgttgctgccgctgctggccCGGCTGTAGATAGACTTGTCCGAGGC
GTAACAGTGGAAAAACACAGCTCCAAATACCAGAACGAGTGCAGCGATCGCAAACACGAGGTCCCACGACCCCGTTGCTTGGAGAATAGCGCCCGTGACC
ACGTTACCAACGATTCCTGGGATTGTTCCGAAAGTGTTGGAAACTCCCATGACGTGCGCGGCGTGGTTTGGCGCCACATCGATCATGTTGACCCAGTATC
CAGCCATGGCAGCGCGACTAGTAAACAGTGTCATACACAGTAACGCGACTGCCATGGGGGCTGACTTCGCGAGACGGAgagagaagaggaagaaggcgca
cCCGAGGAACGAAAACGCGTTCATAGCTTGGCGCACGTGCAGTTCACGATAACCACGAGTAACCAATAGATCGCCAATTCGCCCGAACAGCAGAGTACCG
GTGTAGCCACACATATacggaagcgcagcagcaaagccTCCTTTTTTGGTGAGATCAAGGTTGAGTACTTGGTTGAAGTACTGCGGGATCCAACCCAGTA
AAATATACCACGAGTAATTGTAGCACATGTGTGCGACGTAAATTGCCCACGCAGGCCGCGAAGTCAGCAGGACCCGCCAGTTCATGGAATGGGTGTCTAG
CTCAGCGCGCGAGCTCTGACGGCGATGAGTTTCTGGGTCGACAGTGCGGTTCCGGACGATGAAGCTACGTTCCTCAGTGGAGATATACGGATCCTCCTCA
GGTCGACTCACGCCCATGAACACGTAGACCACAACCCAGGTAAAGCTCAGCACTCCGAACACAATAAAGATACGTTGCCAGCCAGCAGTTGCCATAATTG
CAGGTGAAATGATCAGCGCCGAGATGGTGCCAAGATCCGAGCCACTTGCGACCAGCGATACAAGTCGACTTCGCTCCTGCACCGGGTACCACGCACCAGC
AATTTGGTGCATGCAAGGGAATAAAATACCCTCCCCCAGTCCCATCCCCGCTCTCGTGAAGAACAGACACGTAAGGCACTTCGCCACGACAACCGTTGAC
AAGTCCTGGAACCAAAATACAATAGTGTCAAACTACAAATATCAACTTAATTAATTGAATGGTAGCGTACAAACAGCGTCCAGACGATAACTCCCGTCAG
CAGCACGATTTTGGCTCCAACCTTGGCAGCGAAATACCCTCCCGGAATCTACACCAGTCAATATCTTTTCTTCAGCACAAGAGTTCGTGGGTTCGACACT
TTGCAATGTACACGTACTTGAGTGCACATGTATCCGTAGAAGAAGGCAGACAGTACTTCGCCTTGCTCCTGCTTATTGGTCACAAACGCTGGTAGCGCGA
TGCCCATGTTGGTGCCTGCATCAGCCAGAATCAGAATCTTGAACTTGGACACAACCCCCTGAAAACACACGTACGGTCCGCGTAGCATATCGTGGAGACG
CAGAGACACAAGAACGCAGTCACGTAGCGGCGCTTGCCTTGCGGCAGCTTCGCAGAGGCGTCTCCCGAGCCTGCTGAGACCACGTCAGCCTTCTTCCACG
CCTCCTTGCTAGCCATGCTGCAGATGTCAAATGGCTTGGGGATAGATCGGAGTCGTTACACTCATCAGtgatttcagccaatcacaggaGGATgacccac
ttcaacgtgcaGCACTTCACTCAACTAGCTCGTGGATTCCATGGACAACCAATAATTTGACAACCTCGCACCGAGCGCATAAGCTTTACAAGAGAACTAA
CGGAAGTTGGAGGTGTCTCCTAGCGGCGACTTGGCACGGTACCGCTTCGGCGCGGCGAGAGCGGACGTTTTGGTGGACTTGTGAACTGCAGCCCCTGATC
TGGGGACCTTCATGCTCCTATGCGGGTGGGCGACCACAGGCTTCTTCTTATGCAGACCAGATGATGTTGTCTTTCTGAGTTTCGTTGGAGTACCGTTGAT
CGCGTTCGTAGCAGCCTTGGTCTCAGGCCGATGACCCGGGCCCTTTGCAGTTGCACTTGAGTCGCTTGACTCGGATGCTAATACCGGGGCTGGATCGATT
GTATCCTGGCTGCTACCTGATGAACTTTtagcagcagattcagcgGCCTTGAAGGCATCGATGCTCATAGTGGCGTCACTCTGGGACTGTCCCGTGGTTC
CTTCAACGGGCGTGACGTCATCAATGGCGCTTGGACTAGCACTGGTGTCATTCAACCGCCTTCTCTTATGACCAGCGAGAAACTCGCTGCTTATCGCGTG
TGCCTGGCTGGATGAATTTCTTGAAACGACTGCACCATTAATAGGAACCTTGGTGGCTTCGAATGAAGGGAACGGACGATGATCCTTTTTCATCGGTGTG
TCACCTGTCCGTGCAGTAATCTACAAGCAATAGCCAACGTTTGGTTAGTAGAAAATTCAAAACGAGGAAGTAGTGTAAACTGcaccttgcgcttcttcat
gtagGTTTCTGTAGCTTGCAGTTGCTGCGCCGATGCTTCGCTAGCTTCTCCAACAATTTCCTTGCCAAGATTTGACATTGACACAACCTTTGCCGTCGCC
TTAGACATTTGAGTTTGAAGCCCTTCATTCAGCGTCTTGCACCCGCCAATCAAGAGTTGTCGGAGCTCTTCATGATCACCCAAAAACTGCGTTAATTGTC
CTTGCCTCGTGTTCGACATCTCCACATCAGTCTTCGAGTGTTTCTCCAATAGAGACGACACATTTTCTGTGTGCTTTGAAGGAAGCAAAGCAGCATCGTT
ACTCCACGAAGTTTGTAACTGGTGGTGCGACTGAACCAGCTCTGATTGACGCGATGAGGCCTCACCGAACAGGCTTCGTAATTCGGACAAACGCTCGCGC
AGACCAGCGGTCTCAGTTTCATGCTGGGAATTATGGCTGCTCACTGCCTGCACGAAACCCTTCACTTCTTGTTCCGTGATAGTCTGCACGTATGAAAGCT
GCTTGTGTTGCTTCTTGGAGTTTTCTTCAATCATCAGAGTCTGCTCATCTATCTTCTTGGATTGGCTTTCAATACAATTCTCGATGTACTGAGTCAGTTG
GGCCTTCATACCATtgagttcttcttgttgctggataTGGCTGTCCTTTAGCGCAGTCATGAGTGCGCTTTTGTCTTCGTCAAGCTCCTTAGCTTGCCTC
TCAATTGACATGTCAATTGCAACCTGCAACTCGAGCAACTTATCATTGTGCTCATTGAGGAAGCGGCTCAACTCCTCCCGAGATCCCTCCAGCATCGATT
GCACGCTTTCCAGGAACGACGCATGCCGCAACTTAGACGAAGCCAGATCTTCCGTAAGCACCTTCACGTGGCTCTTTGACATTTCAACACATTTCccgat
ctgctgcagcataGTTTCCTGATGGTTCGTCATCGCTGTTATAACTTCTTCACGTTGTGTGCACTTTTGAGTGGCGTCTTCAGAAATTGCCTTGACAGCC
TCATCTTTGTGCGCTTCGACAAGACCTTGCAGAGCATTTAGACTCGTGATCAAACCATGCAAATCAGTTGAGTGTGACGTTTCCAGTTCGCGCATTGCGC
TTGACACGTCCTGAAGCATGCCTTCCTGACTCTCCTTGTGTTTAGCCAGTCGCTCTAGGAATGCGTTGATATGAGACTGCGAGTCACTATGATACGAAGT
CGCCAGCGCTATGTTTGTTTCTTCAGCTCGCTGGGTATTCTCTACACACAAGAAAGATGAAGCGTAAGCTCAAGCTTTTAGAAAATGAAATCATTGCATC
TTGCGTACCGATCTTCGACAATAGCTGTGCTGCCCGCTTTTCACTGTCATCATGCAGCTTCGCAGCAGTTGCTCCGTCTACCAATAGCTTCTCTTCATTC
TCCTGATAGGCATTAAGAACTCCTTGTACTTGTTGGAGTTCCCTCGTAACAGTTTCCAGTGTTTCCTTCGTGGACATAAGTTCGCCTTCCGTAGCTGCTA
ATTTGCTGATCacttcctgcttctcgaggGTTAGAGCTGCTACCTCGTTCGCATGTTTTTCAGCGACTTCCTCGAGCTCTTTACAAGAAGAGTCTCTTGC
CTTCAGcgtttcttccagctccgttAGTTGTGCACCTTGTCCAGCCAATCGTTCTTGCATGTCAgtgaactgctccagcggGAGATATACGCCATCTTTC
AGTCTCGCAGATCTCAAGGCTGCGCGAAGTGTCTCAATTTCGCTTCCGAAATCGTTCAAAAGTCCTGCTTTAGTCATTTTCTGGTTCAGCTCAGgcttgt
tcttgatgttTTTAGCGCGGAATGCATATTCAAGCGTGCTGAGCGTCTCGTCAAGGCTGTCAGCACAGGGAGCTAGAGTTGCAATGATGGTGGTCTTGGC
TCGGCCTCCAAGTGACTCCTGCAGCAAGCGCGTAAGCTTGCTATCTCGATACGGAACGTGCGGAAGATTATCAACAAGCGCCGTAATAACACGTCCCAAG
GTCAGCAAGCTCTGGTTAATTGTGCCTGCCTCTCGTGCTCTGGCATTGCGTGCTCCTGAGCGACCTACGCACTCTGAGCCTGCAAGATCCACGAGGTTCA
ACTGACCGACACGCAGCAAATCTTCACCCGCGGCATTGTGCTCCTTGCTGTGGATTCGAATCGTAAAAATGCTGTGTGAACGACTGGAGTTCTCGTTCAT
CAGTGTCTCAGACGTGATACGGTTTTTGACGCCAGTATTCACAAGCTCGTACACATGCTTCGCTGTAGTTGCCGTGACTTCCAATAAGTTCATGCAGTAG
ATGCCTCCTCTCTTTGTATCCTCCATAAGTCTCAGCTTCTTGTCTGTATCCGGATCCAATAAATCCTTGAGTTCTTCATTGTAGAGTTGCAGGAAGGACA
CACGGACACTAAACTCTTCTCCACTGGTCTCCAGGGCATCAAAAATGTAGCGTACGCTGCGTGGAATGATGCCAGCTGTCTCACTGCCCGGCGATAGGTC
GCCCTGCATTGTGTACGTCTTGCCTGTGCCCGTCTGGCCGTAGGCGAACACTGTGCAGTTATATCCAGCCAAAGCTTCATCCACTGCAGGGCGAACAACC
GACGTAAATACATCCTTCTGCGTCGAGTACTGCCCGAATACGCGGTCGAACGTGTACGTCTTGCGCTTCACAACAGCCAATTCGTTCGCGTTGGGCTTGC
ACTGCACGACGGCTCCACGGCACGCAGACTTCTCACGGCTGTTAAGGGGGCGACAGCGCACCGCCACCTGCACATTCGTGGGCGTGGGCGGACCTTCGGG
CTcagaggacgacgacatgcgGCGCTGGTCGCTGAGCTCCGTCATAGGACGAGCTCCTTCCTCGGTTGAGATTTGAATTGTATTCAAACTGCGCGCGCGG
aaaagagtgatggtcatcaATATATGGTGTTTGACACACCATTTATGAAGTTTGGTGTTCGGAAACACCATTTTACCTGCTGACCAACCATGCCGGCCGC
TTTGAAGAGCATTCAACTCACTCCATCAAATCGGTCCGTCGAGTcgcaggaagcagcaggaattTGAGCGACATGGCGCAGCCCAAGGTGAACGAGACGC
TACTGGACGGACAGAAGCCCTTTACTGAGTGCGAGTTTGGTCTGGACCGCCGTCTCTCCAAGGCAGTGGCCAAGATGCGCTTCGTGCACGCTACGCTGGT
GCAGGTGCATTGCATTCCTTTGGCTATGCAGGGAAAAGACTTGCTGGTGCGTGCTCGTACTGGATCTGGCAAGACTGCGGCCTTTGCGCTGCCTCTGTTG
CACAAGATTCTGCAGCATAAGCAAGATGCTCCTGCTAGCGAGCCCGCCGTGCGtgcgttggtgctggtgccCACTaaagagctggtggagcagacGCGTC
GCCACATGATGGATCTCATGTACTACTGCCAGGATTCAGTGAGTCTATTGGCTCTGGGAGGACAGAGCATGAACGCTCAGCAGGCTTTGCTTCGAGACGC
ACCGGACGTGCTGGTATCCACGCCTGGTCGTCTTGTGGCACaccttggagctggaaatCTTTCACTCAAGGACTCGGTGCAGACTGTCGTCATTGATGAG
GCTGACCTAGTGCTGTCTTTCGGATACGGTGAGGATATCCGTACTATTTTCAATGCGTTGCCCAAGGCATGCCAAACGTTCTGCATGTCGGCCACGCTCA
GTCCTGAATTGGAAAAGCTCAAGCGCTCTGTCCTACACAACCCCGCAGTCGTGAAGCTTGAGGAGGGAGCGACCGACGGAAAACTACAGCAGTTTTACCT
TCCGGTGAAGCCTGCGGACAAGGACCTGCTGCTctacgcgctgctgcgtcttggcgtcgtgAGCGGAAAggtgatcttcttcgtcaactcGACGGATGCT
GCTTACAGACTCAAGCTTTTCTTCGAGCAATTCGTGATCAAGAGCGCGGTTCTGAATGCCAAACTGCCGCACAACTCGCGTCAGCATATTATCGAGGAGT
TTAACCGCGGTCTTTTCGACTATCTTATCGCAACGGACGATAGCATCGATCGCGATGAAGTTGGagacgaggatgaagacgatgaggaagacgatgagga
agaggaggaaggtGACGACGAGAAATCCGACGCCGACGCTGAATCTGATGTTGAGAGTGATGATGAGAAGAACGATGAAGTAGACAGTGAAAAAGAAGAG
AGTGACagcgagaaggacgaggaggaggctaCGGACAGTGGCAATGAGGCTTCCGAAAATGAAGAGggtgatgaagagcagcaggaaaaGAAGACGGTTG
GCGCTAagcgtggacgagctgctgatGAAAGCTACGGTGTGTCTCGTGGTGTTGATTTCCGCGGCGTTCAGTTTGTTATTAACGTGGACTTTCCGAAAAG
CGTACGTGCGTACACTCATCGTATCGGACGTACTGCGCGTGGTGGAGCATCTGGAACGGCTCTGTCGCTTGTGTCCAAGGAagacgccaaggaggagcgt
GCGCTGAAGCGTGTGCAGGCGAAACAGCAAGCCATCCGTTCCGAAACGAAAGACATCATCGCTCAGCCTGCGGAGTTAGCCTTCGATCTTAAGGAAATCG
ACTGTTTCCGCTACCGTGTGGAGGATGTTCGTCGTGCTGTCACGCGTGTGGCCGTCCGCGAGGCGCAACTGGCTGATGTAAAGAAGGAGATGCTCAACTC
GGAGCGTCTTGAGGCTCACTTCCAAGCGAACCCGCGTGATCTAAACATCCTTGAGCACGACAAGGTTGTGGGGTCTGCACCAGTGCAGGCTCATTTGGCT
ACTATCCCGGACTACCTCGTGCCtattgagctgcagccaccagcaccagcacgcaccaagaagaaacacaaCAAGCGGCAGCGAATTGCTGATGGCAAGC
GTCGTACGGATAACGACCCGTTGCACACATTTGTGGCTCCTGACGCCGACGATGACAAGAAACAAACTGTGGAGGACCGTATTAGCTACGGTAACAGTGG
CGTGGGAAAGAGTACTGCTGGTCGTCAGAAAtggaagaagcagcatcgCAAGGGCCACTTCAACCCCAAGACTattgccaagaagaagttcaggATGAGC
AAGGGCGCCACTCATTAAGAAGTTGGAACAATTTGCAAGGTTGGGGCACATGTTCTTGCTTGTTTTGCCAAATAGATTCACGTTTTTGCTTGATTTTGTG
GTGCTCTGGGTCTTGTACGACGGCTACTGAAGGTTCCGATCCACCGTAGAAGCGAACGCCGGCATTGAGACGGGTCGACTGGTTCCGAAGTAACGTAGCG
CTGCAGGCGGTGCGTTGCTGGGCGGAACAAACATTGCGATGCTCTCTGGGTCtccttcaagctgctgctggactaGTTGCCGCCACAGTTCATCGCCTGC
AAGTTGTGCCACTCGGTCTGCTGGCAGTTCTTCATCGGTCACATCCACCTCAACTAATGCCGAATCTGCACGAGGTTGCAAGGCGTCGGTCATCATTCGC
TTCCGGTCATACGCATAGTCCAAGAGTTGCAGGCTGCGCATGTGTTCAGCATGCTCGCGTTCCACACGTTCAAGACGTCTGTGGTCTGCCTGagtgctgg
ctgtggcaCGCGCTGCCAGGATCTCAGGAGGTGCAGGGAAGATGGTACTTGTTGAAGCCGACAGCGCGAATAGAGGCTTGTTGCGACGCACCACTTCCTC
ACGAAGCGCCCGGAAGTCACGCGACAGGAGAAGCTCCTCTTGTGCAAGTGCCTTCATCGCACAAACCTCTCGAGCTCGTTGTGCTCGAGCATCCTGCTCA
ATGGCCTGGCAGTGCGCTTTGTGAAGCTGGTTCCAGTGGCGGGTCTGGTCGGTACGAGCAATTTGCATGTCAAGGCCGTTCTCGCGGTGATCACGCACTT
CCTCGTTGTGTACGTGACGAGAGATCATAGCCACACTGGCAGTAAATGCGCGAGCCATGTCTGCACTTTGCTGTCTTGCCCGTCTAGCCAATGCctcggc
ctccttcttctgtcgACGTTGCTGTGCTTGCGCGTTTTTTAACTTAGCTACCGCTGCCAGCGTTCCAGGGTCAGGCATGTTGTGTGGACAAAACTTGGag
tgaagaagcgctggagcagatgctgATGAGTGAAGTGACGACATTTGTGGAGGGTTGCAAGCGTACGACTCGTAGGAaaacgtgctggtggcgtcGCTTT
CATGTGCAATCTGATCAAATGGCGATAGATTCGCTTGAGACGGTGACTGATGTTCGCATTGCAGTGGTAACAGCTTCTTGTGTTTTCCTTTTCCACTTTT
CATTGCGCGTTGCTGTTTCTGCCACGTTGAAAGACTACGAACGTGCTCGATAAGGAACGACTCGGTAAACCATAGACGACAACCTTGAATGAAATCGCTG
ACCGAGACTGTCGGTCCTGTCATTGTCGTTTGCTCATGCGAAATACGGGGCGGTAGACGTTGTTCCCATTGACGAAAGGCAGCATCCTCAACCTCCAGTC
CATGAAATCGCAGTAACGGCTTAATCTGCTGGAGCCTAATACGTCGAGTCTGCTGTACCTGTGGATCGAAGGTAACTATGAGCTTTTCGCACGCAGCCAT
GAACGCTAAATGACGCTTTCCACTGCTTTGTGGATCTTCTGGTGATAATTCCAAAGAGGATGGTATTATCGTTGACAATGGGGACGATCTTGATGCGGGG
CTCTCATATGCGTGTGGACGCCGATCTAGCTGCTTTGCGTAAGGCTGCGGACGCTGCAGCATGCGCTTCACGAGTTCGCGATCGCGTACTATCGCTCCTA
AGGTTTTAATTGCTGCGGTTGAGTGAGGCTGGACGAGTGGCACAGCCTGGCGGTACAATTCGAGCATTCTATCGTCGTCCTTGTGAGACCTACTTGAAGa
ttcgaagctgctgccatcgtcaCTTTCTGCGGGATCATCGCCGTTCTCAGACCGAGACAATTGGAATGCCAGAAGACATTCTACGGATGGAGATGTCGTC
TTCATTGTGTACTTCTCGGTTTGCGTGGTGAAAATTCTGCTTGAAAATAGATACTAAATGCTGATTGGTTCAttttgttgaagtggagctacATGGATAC
AAGATGATTCTCGGTGCAATGCACATGTAGTTTATCAAATTAGCGGGTGCAGTATAGTGGGGTCACTCAGCATACTGTGGCGGATTCCGTAGCACAAATA
CAGGACGAGGCCTGCGCTCAGCCAGATAAACACACCAAGCCTAAAGAACAGGTGCCATGTTAGCCTCAAAACATAGAATAGTTGTCCAACCAACATAACT
TGCACGTACCATCCCTCACCAGGGATACTTGACATCATGTACACGTTGGCAAGAATACCCATACAGGGAACCAAAGGCACCAGCGGGCATTGGAACGAAG
TTGACAGATCACTGCGAAAACAAAAATTAAAAATTAATGTTCGTAAAGCCAATTGAAAGTTGATTTCGAAAGAAAAAGTATGGTGCGTACCCGAGTTTCC
CCAATCGGTAGATAAACACGAATGTTGCAATCACCATCATCGCGAACGCGCCTTGAATCGTCCACGGAAGATCAAACACGAAAGACAGCGACAGAGCGAA
GCATGCGATCACGAAGAGGAGAACACGCTGcacgacaccagctccactgAGACTCGGGCGCATGCGCAGTAGAAGCACTCCAGCATTTACAAAGGTGAAG
ACTTGTAGCGTTCCGCACGAGATCACGTTGGCCAGGAAGTCGAGCTCGAAGACAAGCGCTATGGACGCCACAAGAATTCCCGTAATGATAGTACTGGCAA
TGGGCACATGGGTCCGGCGGTGCAGCTTGGCGAAAAGTGATGGCAACAATCCATCTTTTGCCATCTGATAGAAGATACGAGGCTGACCCATAAGGCAGGT
AAACGCTGCAGTGGTGAGCCCGAAAATGGAGCCGAAAGACACGACGCGTCCAGCCCACGGTGCGTCATGAAAAGAAAAAGCATTCACCAACGGAACTTCG
CTACCAAGCACGTCTACAGGTGCCATTCCAGTAACGACCAGCGAAACTCCAACGTAAATGGTCATAGAAATCAGGAGTGATCCAATAATTCCCTTCGGCA
ACGTCCGCTGTGGCTCGTGTACTTCCTCGGCTAAACAAGCCACCATATCAAAGCCCAAGTACGAAAAGAAAACCACTCCGGCTCCTGTCATAACACCGTG
TATCCCAGCAGGCATGAAAGGTTCCCAGTATGAAGTTTCCACTTCCGTACTTCCGTACGCCATCACGAAGAGCAACACTGAAATGTTCAGTAGCGTCACA
AATGCATTGAACTTGGCGGATTCCTGCAATTTAGACCAAGTACGAAAACAAATGTATCATCTACTGGCTACGTATCAATTTGAAGATGAAACGTACATGG
ACGCCAGCGAGAAGGatgcaagtgcagcaaatAATGAGGAATGCGGCCAGGATACTGCACGACATCCCAAGAAACTCTACTTGAACCAGCCAAtgtggaa
gatgaagaccaaAGTGTTGCAGGAACAAGTTGGCATAGGAAGCCCAACTCCGTGCAATTCCAGCTGTAGCAGTACAAAAAGCCCCACATGAGTCCAACCA
GGCCAACATACTGCCAGACTCTAGAACACCCTTACCTGCCGAGATGCCGTACCCCAGCGTCAGATTCCACCCAATAAGCCATGCCGCCAACTCGCCGAAG
GTGATGTAAACGAATGTGTACGCCGAGCCCGTAACCTTCATCCACACACAGTTCAGAGTCTCTCCCACCCTATTCAATCTACTGAAAGCCGACAACGTAC
AGGTACGCGAGCTGCAAACTCTGAGTACGTAAGCGACGTAAAGATGCAGGCAATGCCGCTAATGAGGAACGACAGGGAGATGCTCGGTCCCGCGATCTGT
GCTCCCACACCGACGAGAGAGTACACGCCGGCGCCTACAGAGCAACCAACGCCGTAAGCcacaagatccagcagcgtcagaCACTGCTTCAAAGAGCTGG
GCCCGAGCTCGCAGCGCGACAAAGGCTTCACACGGCCTGCAGCCTCCAGAAAGCGCTCCATGGCGAGTGCGACAATGGGCGACGGGCAGCTACGCTGGAC
TTGTCTTCTCCGCAGCTGCACAGCGTGCCCCTTGCTGCGCAAACTGAGTCAGAGGCAACACGGTAAATGGTTTCAGCCAATAGAATGAATTATTATGTAT
GATTGGATGAAATATTCCCGTATCCAAAAGGGGGCGAGCACTGCACAAGAAGTCGAACAGCTTGGAAGATGTCGGCCGTTCCCGAAGATGAGCGCACTCA
GGTGCTGAATGCGTACAAAGCCAAGGTCATGGAGCACCGCGAGATGGAAAGCAGGTTCGTAGCTGTTTGCTCATGCAAGAAAGACCCCCTAAGACGTCGT
AGATTTTCCCCTGTTGTGCTGCGATCTTCCGGTCACTTCTTGCTTGTTGCTGACCGCTTTACGATGATTTCCAGGGTGAAGAACATGCGCGAGAACGTCA
AGGCGCTTGTGAAAGATTTTAACAAGACGGAAGACGAcctcaaggcgctgcaggtgCGTACAATTGTACCTCAGTTAGTGTTATTCATTTAGTTGACTTT
ATTTTGCTGCAGAGTGTGGGCCAAATCATCGGTGAGGTACTTCGTCAACTGGACGAGGATCGCTTCATCGTCAAGGCCTCCAGCGGCCCGCGTTACGTCG
TAGGATGTCGCGCTAAGGTGGACAAAAGCAAGCTCAAGTCGGGCACCCGAGTGGCGCTGGATATGACGACGCTCACCATTATGCGCTACCTGCCACGTGA
AGTGGACCCGACGGTGTATCACATGTTGAAGGAGGACGCCGGCAATGTGTCGTTCTCAAGCATCGGTGGTTTGAATGAGCAGATCCGTGAGCTCCGCGAG
GTCATTGAGCTGCCGCTTACCAACCCCGAGCTGTTCCTGCGTGTCGGTATCAAGCCCCCCAAGGGTGTGCTCCTGTACGGCCCACCCGGTACGGGTaaga
cgctgctggctcgTGCTTTGGCGTGCAACATCAACGCTACGTTCttgaaggtggtggccagTGCTATCGTCGACAAATATATCGGTGAGAGTGCCCGTGT
GATCCGCGAGATGTTCGGGTATGCCCGCGACCACCAGCCGTGCGTCATCTTCATGGATGAGATTGATGCCATCGGCGGAAGTCGTTACTCGGAGGGTACG
TCCGCTGATCGTGAAATCCAGCGTACgctcatggagctgctgaaccagcTTGATGGTTTCGACGCGCTCGGACAAGTTAAGATGGTCATGGCTACGAACC
GACCGGATATTCTGGACCCTGCTCTGTTGCGTCCTGGTCGTCTCGATCGTAAGATTGAGATCCCGCTTCCCAATGAAGCCTCGCGCATGGATATTCTCAA
AATTCACTCGGGCCCCATCACCAAGAAGGGCGAGATCGACTATGAGTCAATCGTCAAGCTCACAGACGGCTTCAACGGCGCCGACATGCGCAACGTGTGT
ACCGAAGCAGGTATGTTCGCTATCCGAGCTGACCGTGAGTACGTTGTGGAGGAGGACTTCATGAAGGCAGCGCGGAAATTGGCGGAAACCAAGAAGCTCG
AATCCAAGATGGACTACAGCAAGGTTTAAATTCGCGGACAATGTTATCTGGCGTTGGGGTGCTATTTCTCCAGGACAGAATTGAGAAAATGACCACAGCG
CGGTGGATCACTGTACCTTGATGTTTCTTGTGTCTCTCCTGCTTTCAGTTTGGATTTTGGACCTACTATTTTATCTGCGCCGCAAATAAACCGAATACGG
GGGCTAACGGTAGTTTTGCATTTTACATCAGGTTGTTTCGAGATGGCGTCGGTAGGTGGGGCAGGCATGGAGTGCTGTGAGCTGGTAGGTCTTATGGGCG
ATGTGGCATACCAACGCTGTAGAATGCTGCTTCAAGAATTGCGCAAGCTGCACCCAATCTTCGTGTCGCCTCTGGAAGGGATGATGGAAGTCGAATACCT
GGAATATTTGCAGAGCCTACAAGATAAAATCCCCAAGAGCAAGCGAGGAGAACTTCTGCGGACAACTCGGCCGatcattctgctgctgggttcCTCAACT
GTCGtgctggatggagaagacgaatTGCTAGATTTCGCCATGGAGCAGACTCAGTTATCCAAGAACGAattgcttgctgctgctgcatttggaGACGTTG
TAGCTGACGGCGAAGGCACTGACAGCGCCAGGAGTGAAAAACTAGCACTGGCTGAGGAAACACTGGAGGCAAaggcagaagaaggagcccAACAAGCTCT
GGCACGCCATCGGGAGCTTTCAGGTCACCAATACGCTTTCTTGGTTTTTGAAGTTGATGGGGTAGCGCTGCCCAGGGTCGAGCTGGAACTATTCCACAAC
GTGTGTCCTAAGACATGCAAAAatttcttggccttctgTGAACACAAAGTCCCTGATATTAGCGACGAAGCTCAACACTTGGGCTACAGAGGCAACACTG
TGCACCGGGTTGTGCGTGGTGGCTGGATTCAAGCTGGTGATGTTGCAGGTGATGGACGTGGAGACGGATCTTGTCGATCTCTTTACGGCCTTGAATTTCC
CGACGAAAGCTTCGCCATTTCACACGACGCAGCCGGCATTCTTGTACGTACAAACTTTTTTATTTCTGTTCCCATCTCTTATCAGCATTTTGTTGCAGTC
CATGGCAAACTCAGGGCCTCATACAAACGGCTCACAATTCTTCATCACTCTTGCGCCGCAACCATGGCTTGATCGTCATAAAGGTAAGACAGACCGTGAA
CTCCACCCCAGCATACAACCTCACGAACCCTTTTTGATGCACGCCAGTTGCCTTTGGTCGAGTGGTGAGTGGGTGGCGCACCATCATGACTATCGGAGGC
CTTGAAACTCGTCAAGAGCGACCTTGTGTGCCCTGCACTATCGTCGATAGCGGAAGGCTCCAGTGA