Description :
From Genome Similarity Track
Location :
Scaffold_16:51075- 81331
Transcript NameFunction/comments
Phyra_76057unnamed protein product
Phyra_94350ankyrin repeat-containing protein
Phyra_76060proteasome subunit beta type-6, putative
Phyra_76061endoplasmic oxidoreductin, putative
Phyra_76062cysteine protease family C26, putative
Phyra_76063aldehyde dehydrogenase, putative
Phyra_71382carbohydrate esterase, putative
Phyra_76065cysteine protease family C26, putative
Phyra_71383seryl-tRNA synthetase
Phyra_76067COP9 signalosome complex subunit, putative
Phyra_94355PREDICTED: ELMO domain-containing protein 1 isoform X1

Sequence
30256 bases(100 bases per row)
TGCCACTTCGCCGCTTCGAGCGTATTTCAATGTCTCAGGGTGCCAAGCCGTTGACCGTGAAGACGCAGAAGTACTCGAGTCTGTTGGAGCAGCGTGATGA
CGAAGATGTGTATAGTGAGATGAAAACTCCGAACGGCACGGATGAAGACATGTCGTCGCAGTCGAGCCGCTCCTCGAACATTGGCTCTATCACGGGTGTG
TCTGGAGCCGAGTTTGAACGCACAATCCCGTTCGCCATGGCGTGGAACCGTTGCCTCACTAGTCTGCGTGAAGCAGATGTGATCAGCGACCGCGAGCTGA
ACGTTCTGAGCTATTTGATCGATTCTAAGGATACAGTTGGTCGTAAGCTGTACCCGCCGGCGTTCTTGACGGCTGGAAAGTTGGACGAGTCGATTGATAT
CGTCCTAGAGTGCTCCGCGTTGTACGAGAAGTTGAAAACCGACAAGAAGAAAAAGGACAAGACTCTTCAAAAGATCGAGACGACTATGCGTGAGCGTCTG
ACGAAGGACGACCTGCGCGTGGAGTCTATTCTCGGATCCTACAAATTCTCTTCACAAGTTCTGCGTATTCTTCTGGGCGAGGAGCACAAGGAGCTAGACG
ACTGCTATAACTTCATCGAGGAAATGGCGTCGCACCAGCAGATCCTGAAGGGCTTAAAGCTGGACAACCTATACATGTGCCGCGCAACAGCTGCTGAACT
GATGAAGGCAATTTTGGAAGTGCCAAAGAAGTCGACAGAGACTAGCATCAAGTTCCAACGCGCGCTTTACAAAGTCATCGATTCGGTCGAGTCGGTGATT
AACTGCCTCAAGATGGTCCTCGGAAAACAAGAAAACTTGGTGCAGATGCTGAACGACACGCCACTGAAGCCGAACTCGTTTTTCTTCCCTGGCGATTCTC
AGCACTATGCGAGCCTTCAGCTTCAGAAAATCGTGAACGATGAGGCTGCTCTCGATATTGTGTCGCGTGCGTACCAGTTGCTAACGGTGGACAACTTTGA
TGCCGAGCCTCGCTCGGAAGAGGGACGTCGCCGCTTGCGTTTCTTTGCCAACTCGCTGTTCATGGACATGCCGGAAGCGAAGCCTATCCGTAAAATCCGT
TCGCTGACGGTTTCGACACCATACTACAACGAAATTGTTATGTACTCGATCAAGGATTTGACGGCACAGAATGACGACTGCATCAAGCTGTTGTACTATC
TGCAAACCATCTATCCATTCGAGTGGGAAAACTTGCTGGAGCGCATTCCGGCCAAGGACATGAACGAAGCGCTTAAGAAGAACCCGGAGGAGGTTCAGCT
GTGGGCCAGCTACCGTGGTCAGACTCTGGCGCGTACTGCACGCGGTATGATGTACAACGAAGAAGCTATTCGCTTCCTTCACTGGCTGGAAATTGGCGAA
AACGAGCCGATGCACCAAGTGACGTGCTCGTGCAACAAGTGTTGCAAGTTGAACGAAATGGTTGCCCTGAAGTTTAATTACGTTTGCACGTGCCAGATCT
ACGGTAAGCAGAAGGATGAGCAGAAGCAGCAAGCTCAGGATATCGATTTTTTGCTGCGCAAGCACCCGAACCTTCGTGTTGCTTATGTGGACGGACCAAA
GAAGGTGAAAGATGGCCCGCCAAAGTTCTTTTCGGTGTTAATCCGGGCTCTGGACGATAAAATTGTTGAAATTTACCGAGTGGAGCTGCCGGGTAATCCG
ATCCTTGGTGAAGGTAAGCCTGAGAACCAGAATCACGCTATTATCTTCTCGCGCGGTGAGCTACTGCAGTGTATCGATATGAATCAAGACGGATACCTTG
AGGAGGCTCTCAAGATGCCGAACCTGCTGTCGACAATGGATAGTGGCACGGAGAAACGCCCTTTGACAATTATTGGTTTCCGTGAGCACGTGTTCACGGG
CGGTGTGTCGAACCTGGCCAGCTTCATGTCGATCCAAGAACTGTCGTTCGTATCGCTTGGCCAGCGTATGCTTGCCCTTTTCCATGTGCGTCAGCACTAC
GGTCACCCCGATATCTTCGACAAGCTCTTTGCCATGAGTTGTGGTGGTACTGCCAAGGCTTCCAAGGGTGTGAACCTTTCGGAAGATATTTTTGCTGGTT
TTAACTCTACTCTACGCGGTGGCCGTACTTCTCACGAGGAGTTCATCCAGGTCGGCAAGGGTCGTGATGTTGGTATGCAGCAGTTGGCTCTGTTCGAGGC
GAAGCTGTCGTCGGGTGCTGGTGAAGCAGTTATTTCCCGTGATGCGATGCGTATGGCATCTCGTCTGGATTTCTTCCGTCTTAACTCGTGGTTCTACGGT
AACTTGGGTTGGTACTTCACGCAGACGATGACGGTGGTGGGTGTGTACTTCTTCATCTACGGCAAGGTGTACATGGCTCTGAGTGGCATGGACAGCTACT
TCCTTGAGAAGGGTGGACTGGGTATTGCCGGTACGCTTAATACGTCATGGGCGTTCCAGTTCGGTTTCTTGTTGGTGGTGCCTGTTATTGCCGTTGTTGG
TGTGGAGCAGGGTTTCCGTCATGGTTTCACCTATTTGCTGTGGAACATCATGACTCTTGGTCCGATCTTCTTCACGTTCCAGATGGGTACGCGTATGCAC
TACTTCGACCGCACGCTGATTCACGGTGGTGCTAAGTACCGTGCGACGGGTCGTGGTTTTACGATCAAACACGAGAAGTTTGCGGAGCTCTACCGCTTCT
ACGCATTCAGCCACTTCTACCGTGGTGTTGAGCTGCTTTTCCTGCTGTTGATGTTCTACGCCTATGGCACGTTTTCATGGTGCAACTGCTCGTGGCGTCT
GGATGCTGACTATTACAACAATGTCGAGCCGACTGATCTCGAGTGGCGGACTCGTTGCTACGATGATCACTACCAGTCGTGTGTTTTGCCGACCAACCAA
AACTACGGCGTTATGTCGTACTCCCTGTGGATCATTGCGGCGACCTGGATGTGGGCGCCGTTCTTCTTTAACCCGAGTGGTCTGGACTGGGACAAGATCA
TTGAGGACTACAACGACTGGCAGAACTGGTTGAAGACGACAAACGACTCGGCTGATAGTTGGTTTGGCTGGTGGTCGAATGAGCAGGAATACCTGGAGCA
CACAACTGGCGGTGCTCGCTTCATTACTGGCGTGCGCAAGCTCCGGTTCCTGTTGATCGCTGTCGGCATGTACCTCAACATGATGTACAACGCGTACTTC
GAGAGACCAAACAGGATCATCACATCTGACGACGATATGCTGACGTACGCTCTGTCTGGCCTCGTCATTGTGATCCTCCTGCTGTTGATTTGCTGCGGTT
ACATCGCCAGTCGCGTGACCAAGAAGATGTCGATGAAGCAACGCAAGCTGCGCAAGATCAAATTCTTGTTGTCGTGCTGCTGCTTCTTTATCTCCATGCT
GAGCCTCACGGTGTTGTCTATCGGCAACCTATTCACTATCTTCGTTCTGCTGTTCGTGGCGGTCTACTGGTTCATGCAGATTTGCATCCTGCGGCTGCAA
TACCACCACATCGTGGTGCGTGCGCTGGCGCGCGCCTTCGACCGCGCAGTTGGCTGGATTGTGTTTGGGCCCATTATGATCGTGTCGATGTTCCTGCCAT
TCATCTCCTCCTTCCAACAGCGTGTCATGTTCAACAACGCCTTCACCTCGGGTCTCGAGGTATCGAAGCTCTTCGCGCACGACGTGGCACCGGCACAGGT
TGTCAAGGTCAAGCGTGTTTCGAAGAAGAAGAAAAGCCGCGACGACTAAGCGAAACCATTTGCTAGGACTTCTCTGTTGAGTTGATCGGTCAGCCAGTCT
TGCTATTTTGTATCTTCATAGAAAACAAAACATTTTGTTCTCGACTGCTTTCAACGCGTCTTCTGTTCTCTACATGAAATGCGAAGATTAGATAAGGGTG
GCTAGTGATCAACTTCTTCTAACCTTGCATTCGGGTGAGGTCCGGGGTTGAAACAACATGACGCATGCCAACGAGCTCTGCAGCCGAACGACTGTTCATC
CCACTGTGCGGACTCACGACATTCCTTTGGGCGAATGGAGCAAAGCTGCCCGACGCACTCAAAGGAGATCGAGCGTTGTTGACGTGAGGTGGAGAGCCAA
TCTTGAGTTTGTCCAGAATCTCGGAAAACTTCTGTGTGTCCGGCTGGAAGCGCTTCAGATCCAATTTTCGCCGAGAGTCTCCTGCCCCATTCGTTTTCCG
AGGACCTGAACTCGAACCACTCCCACTATACTTGAGCTCTATGGAAGACCGCGAGCGCACGGTGGGCATCGTCAATTCTTGCGAAGGTGACGAAGTGTCG
CTGCCAAAATCGTCATCTTCTCTAAAATCTCCAGATAGTGGCTCGGTATCACTTTCAAGAGATGACATCGTGTTACTCCTGCGGCGGGCTCCGTTTTCGT
CTTCTTCGGCCGACAGACGCGAGCTTCGACTACCTGAGTCACTCTTTGGAGCAGCGGTTACCACGTTGGATGCACCAGCTGTCATCTCTCGCATGCGCAT
CACGTCAAACTCTTCGGCGTCAACTTCATTGTCAATTTCAATCGCCATTGCGCTTTCAGTATTTCCTCGCGACATCTGGGTAGCCAGGCTCTGGATGGCA
TCTTCTATCGCGTGCATCCACTGCTCCTGACGCCCCCACGTGTCTGTAAGCACAATAAAATTCTTGTATCCCTTTGACGAAAACTGCAACCCGTGTGCAC
CACTTCCGGGGCCTTCTGTCACGCCGAAGCTGTACCACTTGCGAACGGATGTGGGGATAACCCACTTCATACGGTTTGTCCAGTTGGCGCTTTGAAGCGT
ATCACAGTACCAGAGCTTATCGCATACTTGGCACAGCCCAAAGAATGTGATGGTAAACGTGAGGGCATGGAATGGCATTGGCACTGGGAACTGGATAAAT
GAGCTCACACGCGTGGGTTCCGGTATAGGAATATGATCGTGAATCTTGTCCTTCTTGTACATGAATCCAGTGATGAACTCGTCCGTATACGTGACCTTGC
AGTAGTGGCTTGCTGCGCCAGAGAAAATGGTCTCCAAATAGCCTGTGTATTCGTCCACATCTGCATTGGTGAGCGTGGCCGACACGTATTCGACTGCACT
CTGCTTCAGCTTTAAACACCCATGACAGAGCGGCGCGTTACGCTCACCGAGCGGCAGCATCTCGACACGGTTCTGCTCGGCAAGAGTTTGCTCGAACTTT
ACCCACTTTTGGTGCTGTGATGTATACTGCCGCACGACATCTTGACACGTTATCGCAACTGATCCGCTTCTGCAATTCGGGGTGCTGCAGCAATAGAAAC
GTTTTTGTTAGTGCACGCACGGGAATCTCAATATACCACACACAGTAGGTACGTACTTGGTCAGTGTGAAGATACTGTTTGCAATAGTGGTCATGTGACC
CTTGTACTGTACGTGCTCTTCGTATGCACGGATGACAAAATCCAAAATGTTAGCCCCTTCGATGAAGAGGCTATTCAGCAAGGGCGACGAAGGCAACCGC
TTTTGATCAGGATCCAACAAAACAAACCGAATGACGTCCGTAAGTTCGTGATGCAGCATGCTGTTGCTGGGGTGCGATCCATAGCACGCCAGCAAGCATG
GCATTAAACCAAAATTGGCCAAGAAGTAATCAACATCTCCACTTTGCAACAGAACGCAGCGCTTGAGAAATGTGATAATGTGCAGAAGAGCAGACCCTTT
GGTATTAACCGCCTTGATACTTCCTGGATTATAAGAAGTTGACATTGTGCGAAGCTCGTTGACGTCCGACGTCACCACCGCTCGACACAGTTTCACAAAT
TTCTCCACGCGCGGGATTAAGGCACTCAGTACCGACACATAGACCGTTTTCAAAAGACCTTCGATACCTGTGACATCGCGCTTCTTCTTGTGATACCCCA
ATGTTCCCATCAGCATCATGACAATCGACAGAGAGCCACCTTCACGGACAACGAGAGACTTACACCCTTGAGTACACTGACGGCAAACCTCCGCAAACCC
CAAATCAATCAGTGTACCAAACGAAACATCCGACGTATTGAGCAGAAAAATGAGCAGCGACTTGAAAAGTTCGTTGTGATGGAGAGGGAAGTGCTGATCC
GTGATCAATGGCAGGAAATGATCTGTGTTCTCAACAAAAGTGGCCACATTGTTCATGATATAGACCGACGGTGGATAAATGATGTAGTTTATCAGCGAAC
AAATGTTTTCAACGGAGTCTCGCTGAAACGCTGTCCCCACACCCCAGCCAAGCGTCCGTTGCCAAGAGTACAGACGAGCAAACAAACAGTCGAATATCCC
GCTCTTCTGCACGTTCAATTGGCCTGCCTCAGACATGTCTGAGTACAATAACCATACGACTGTATCACGAATGGAATCCAGACCAATATGGCAGACCAGC
CAAGGTACAATAAACCTTCCTTCGTCCGCCAGGAAACGCCACATGAGCTCTCCAAGGCTCTGGTTCACGATGAAATGGTTGACAACCTTGCAGAAAAGGA
CCAATAACACATCATCTAACGGTTCTGCGGTGCACACGAAGTTAAAAAGTACTTTCAGGTACCCCGATGAAACCTCGACATCGAACCCATCAGAAATACT
TAACGTCCACCCCGCACCACCAGGCTTGTAACCTTTCTGGAAAATTTTAGGCGAGTACCACAGCGCAACCTCGCTGCAAAAATGCTGGACCGTGTACTTC
CCGTAATTAGGATCTTCGGTTGGGTCGGATTCGGACGATGACACGGGAACCGTAAGCAGGTGAAACACTTCATAAATAATCCGAGGCTGCTCGAGCCAGA
TACTGGACTTGTGCTCTCGTATCATCTCTCGGTACAAAATGTCGACTGACATTTGGCTGCTTTTGGCAATCTTCAGCAAATCGCGAAGCGTTGAGTTTGC
TTTGGCAACAGTTTCTTCAATCTTGCGTCGATGGTTCTTTACGGACTCCTAGCATTTGAAAAGGGATTGCAAATAAATGCGCGTTAGAAGCAGTCTTCCG
GATAAATCAGTTTGGAGAGACCGTGAGTCCGACGCTGGTCACTCACACTTTCAGCTTGTTCACGCAAGAAATCTTCAATATCAGTGTGCCCAGTCATGCG
AGCCAAATGTTCTGCTGTGTTGCCATCTCGCTAAACGTCAACGTATTCAATCCTGTAAGTGTTGATACGCTGTGAAGAAAACGAAAGCATATCCATCTAC
TTACGTCTTTTGCGACCAGACTGGCGCCGGCGTCCACAAGCACCTTTACACAACCGAGGTTTCCGGCGCGGGCAGCTTCCATCAAGGCCGTAGTAGAATT
TGGCTGAGCAAAATACGACACAGGAAGTCAACAGATCATGCACGAGTCAAAAACTGCGGAGGCTAAAGACTACAAATTGATCACCGTACACTTAAAGTCT
CGATCTCTGCCCCTCCTTGCAACAAAATCGAGCAGCATTCCTCAAGGCCACCTCGAGCAGCGATGTGAAGGGCAGTAGTTCCACGGCTCTGTACAGTAAC
ACGAAACGTTACGACCACATTATCGGTAAACAACCATTTTTCTCGCCAAGTACCACGAAACGATACATGTACGTACTCGGTTTCTGGACAAGTTGATTCT
CGCTCCCTTTTTGACCAGCAGCCTCACACATGCCGCGCGTCCATCACGAGCTGCAACCATCAACGCGGTCATACCATGCACCTAAAATAGTGTTTCGTTA
GCCTTTCGCAGCAGTCAACAGTGCTGTGGCAAATAACATAAAGTTCTTACATCTTCCAAGTCGAGACTTGCACCAAACATCAGCAGCGCTCGTGCCGCCT
CTACGTTTCCGACTGAGCAAGCCATCATAAGAGGGGACACACCCGTTGGCTAGAAAAATCGTATCAGCACAATTCCTACTTATCAATCAAATTCATGACA
GCAAAGCTACCTTCTGTTCATCCAGCGATACCCCGAGACTGTGCAAAATCTCAATGCAGTCCACATGTCCGTTTTCAGCAGCATCACAAAGCGCCACCGC
CTTTGGAATATTCTGTCATCAAAGCAAAGAAAAACGCAAAATCAGCATTACCACACAGAAATCACATTTCGAAACGACTGTTCTGCTACTCACATTGACC
ACGTCTCCTGTCGTGTCGATCTCGAGCAAGTGCTTCAGCAGTTCCATATCTCCAGCCCGTGCTGCAGTCTGGACGCCAAAATACACGTCATCAGGCACAA
CATATCTGCACGCCTGCTCTCTCCACAGCAGCTCGATTGAGACCCTCGACGGCTTATCCGCCAACAATTGGTCCGCGTGATACTTGGCCAGCAGCACAAT
AGGGATCGACACTGACTGACGCCCCGACGAGTGGAAGCCGTCGAACAGAGACTGGATCGCGTGTTTGTTGTCCACCCTCTCAATGAAAACAATACCTGTC
ACACCCACAGCCAGCAGACGCCGCACAATGTCCGGGAAGTGGACGCGGCCCCCTCGCTCGACCACCGCGATGTTCCCCAGCAGCGCTGCCTTGTTCCGCA
GCTCTCCATCAGCTTTCGGAGGGTTCGTGAACACCACAGTGCCCGTGACCACGCGCGGCACGCGGTCGTAGCGGTAGCTAGAAGGTTCTGCGAAGTGGAA
GCTGGTAGAGGTCACCTGCACGCTGTTCTGCGAGTGGAGATTGGCGTCAATGTCCTCGGCAGGCGACACGGGCGGCTGCTTGGGGCTGCACTGCCAGCAC
ACGAAGGGCACGCCGTCACTGCGCGAGCCATTGGTCGTGGACTGCTCGTTACCCATGCTCCGATGCCCCCGTGGCGGCTAATGCGGAATGCGGAAGGGAA
ACCAAAAGACAGGAGTGATGGTCACTCGGTCAGCCACTGAGTTCCTCTAAGGCGGTTAGAGGCGTAGGAGACGCGCTCGCGAGGTGCTCGGAGACGGAGT
CGGTGGGCAGGCGGCGCGGAGGGCTGGTGCGCGATGAGAGGTGGTGGTGGGTTTGAAACCCAGCGTTTCCTTGGGGTGGTTGCCTGAGTTCTTTTTTTTA
GACTTGAAGATTCCTACAACGGCAGTTGAAGCAATTTACTTTAGTTTTGTATGCAGGTGCTGGCATGGGACGGCCAGCCGTTTACCGATCGGGAAAAACT
GAGTTTTCACTGCAGCTGCAATAGGCAACACCGGCACACTTGCTTGCCTGCGCTGTACGCGACTCAATGGGGTAGCTGCTCACTGAGTAGTGCCCAAGGA
AGTGTTACATGTACGCCATTCAGCAATTTCACATCAGAAAAATGGACCGCCTTAAATAGAGGCGACGTGCTCTGGTGTTTGCAGCAATCGGACTTCGGAC
AACATCGCACTATACATATGCACAGGGCTGCTACGGGCAGTCCAGCAGGCCCACAGATGAAGAGCTCGGGGCATTGCTGCAATGAAGTAGCTGATCTGAC
TAAGTCATCACCGTTAATAACTCACTTGCCGTTGTAAACATTACCTCAACTTCCTACTGGGACTTTTCTTTTGGGACTTTTCCACAACAACCTTTTTCGC
GACCCAAATTCCGCCGAGATGGCAGGCCGCACCAGCTACGCGCACGTACAGCAGCAGCTCACTAGCAAATGGTCCACGTTGCGTTATCGTATGGAATATG
GTGGCTACCTGTCCAACCACCTGCTGCATGGCGTGGTGGCGCTCTTTGACCTCGGCGCGAGCGAGGAGAAGATGGAAGATTTTGTCGACAGCTACTCGAC
CAAGTTAGAGAAGGTGGAGCCCGACCACGAGGACGTGACGCAGCTTGAAGCCCAGATGAAGGTTTTACAAAGCTCCAAATTGACGTTCGAGACTGCACGC
AATTTGCTGGGCAAGCGCCAGAATTTTGACGGGCTCGTGGCACTGTACGCCACAGAGGTGCAGAGACTCGGAATCGACGGTGCAGTGAAGAAACACTTGC
CAGTTCTTGTCGGGGGGCTGGCTGGAGCACTGCTCCACTCTATCATTCAACTTGGCTACGCGTACCATCTTGGCGGCGAGCGTCTCGTGGCGGAAGGGCT
GACGTACATGCACTATGCATACCTTTCGTTTGACGAGCCTAACGGAGATGAGGAGATTTCGGACAAGAAGCAACTCACACGTGAAGAAGCTCTGATGTTG
GTGCGCACGCTGAACGGCAATGAGGTTTTGCCGAGTGAGATGCGTAGAATGCTGAAAACGAAGCCGCTAGCTGATCTCCAGATTGGCGGCATTCAGAAGC
GGCTGAGCACGATGTCCGGCGACTTGGAACGAGGAAGCACCACAGCGTTTCGGCTGATCTGGGATACGATCCACAGCTATGAGTTGTCTAAAATGGATGG
CGTGTTTGCACTGGATGTGGCGCTCTGGCTGTACACGATGATCGAGCACAACGACTTCGTCATCCTGCACGCGGTGACATCGGCGTGGGCTCTGCGGCAG
GTAGAGAACTTGCTTGAACCAGCGGATCGCGAGCGGGCGTGGAAAGTGTGGCTCCATGTAGCGCTTTCAGCGTTCGTCACGAACGAGATCAAGGATGTCC
TGCCGTCGGACGTGTGCGACCAGCGGTTAGACGAGCTGCCAACGCTGGACCCATGGAACCGAATCGTAGCGAAGACGTTGGGACTCGCAGATGGAGGGCT
GCTCGAGCGCGATTTAGTGCACGCTTACAAGCTCGTGCAAGTGGCCCACGGCCACGCCAAGACCAGCGACAACGGGTTCCTATCCGGCGGCGAGCGTGAC
TTCATTGCCCGCAAAAGCGCGCTCAAGGTGATTTCTCTCGAGTTCGGCCCACTGCTGCTGAATTAATGAGTTGATAGCGTTGATATAGCTACGAAGAAGT
GCATGCCTTTCGCGTTCTCGAAAAATCGGTTTGTTGAAGTGGGATGTTGCACGAAGGTAACGCGCATGCTTTTTTTGACACGTAGTGCGCATTTCATCAG
AGCACCTCGTCCACCATGGCGATTCCGACGTCCTTCCGACGCCTCCTGCGTTTCAGTATCCTCGCTGCAATTGCCATCTCTACATCAACACAGTCTCCGG
TTGCGGTAGCAGCTTTTGCGGACAACGCACCCACGACATTTCCGAAGGATATGGTGGACTACCTGCAGTGCCAAGTGTGCCAGACCCCGGAGCTCACAGG
CAGCGTGCAGGACTCGGCGTGCGACTACGAGACGGTGGACAAGGCCGTGAACGAGCACTTCCACCCGCTGCTGCACGAGCTGTCGCGTCTCACGTTCTTC
CGCTACTTTAAGGTGGATCTGGGCAAGGAGTGCCCATACCTGCCGTGGCAGGACGATGGCATGTGCGCCAGCATCGACTGTGCCGTGTGTGAGTGCCCGT
CGCACGAAATCCCAGCGCCATGGAGTCAATTGGATCAGCAGGAGACACAATCTCGCCAAGCTACGCAGTCGGAGGAGGCTGGCAAGCCTTGTGACGAGCA
GACGGGCGAGAGCACTCTATCCAAGGTGGAGCGCAAGAATGCGGTGGCTGGAGAGAGCTTCAACGAGTGGGAAGAGGTCTCGAACACCAACGTGTGGGCT
ACGCAGGGAGGAGATGAGGAGACCATGGCGTATATTAATTTGCTAGAGAACCCAGAGAGATACACAGGCTACAGCGGCGTCCAGGCGGAGCGCATCTGGA
AGGCAATTTATGAGGAGAACTGCTTTACGCCATCGGAAGAGAGCAAGCTGGATGGTATGTGTCTTGAAGAGCGTGTGTACTACCGCCTCATTAGTGGCCT
TCAGGCGTCGATCAATACGCACATTGCGCTGACCTACAAGTTCGGCGACGGCCAGTGGGCAGTCAACCCTTCTCTCTTCGTCCACCGCGTTGGCAAGCAC
CGCGAGCGGTTGCAGAACTTGTATTTTGCCTACCTGTTCGTAATGCGTGCGGTCAGCAAGTATCGTCATGAACTGCTTGCGTACGACTACAACACGGGCA
ATGCTGCGGATGACTTTCGTGCGAAGGAAATTCTGCGCCAGCTTTTGCTGGAGGGATCCGACGATGCCCGGGCTTCGGGAGTAGCCTGCCCGGCGTATGC
CGAGTGCTCATCGGTGCTGTCTGGGTTCGACGAGAGTGCACTCTTCCGGGTTCAGGCTGACGGCTTGTCGATCGATCAACTGGCACAAGCTAAGCAGGAG
AAGGAGCTACTGGAAGTGCAGTTCCGCGAGAAATTCCAGAACGTCAGCCGCATCATGGACTGTGTCACGTGCGAGAAGTGCCGGCTCTGGGGCAAGCTGC
AAACCATGGGACTCGGCACGGCCATCAAGATCCTACTTGCCGAGGACGTTTCGACGATCCCAAAGCTCCACCGCAACGAGCTCATCGCGCTCATCAACGT
GGCTAACAACCTTTCCCGCAGCGTAGACGGTGTCAAGATGATGCGGGAGCTGGAGTTCATCGAGGCCGTCAAGCAGTTTGGCTTCGTTTGCGGCAGTGCG
GTGCTGATTGTACTTGTGCTCATTGTCACTTCCCGCAAGCGCAAGAGTAAATTGCGAGTACACAAGAAGCAAGAGTAGCCTTTGCAGATAGAGAAGCTGG
TAAAGGCAGCATACTACGTACATTTGCTAATTTTGATTGAGACTGCCAACAGTTCTGCCGGAGCTTACGTAGCATTTCACGTGAGCGTTCAGCACTAAGG
ACGACATCGTCAAGAACTTCAATTGACCCGAGGCTACACATGCCGTTCGTTTGCAAGCAGTACTCATAAGCCACACTAGATTTATTGGTCATCACGTGGG
CACACAACTTGCATAATGTGAGGTTTTGTACGCAGCAAGCATAAAACAAAACCGCACACACAACTTGCGTCCCCGTAGAGAAATATTGACATCACATAAA
GTGGCGAAGAAGAAGCCGACTTCGAAGTATCTTGCTGCTACTGTGCAGCAATTCCAAAATATTTCCTTCTAATACGCTCCGGTTTGACTTCGTAGTTGTC
CTGCATCGGAGTTCGCGCAACTTTCTCTCCTCACTTATCGTATTGGCGCTCAAGCAGTCCTCGAATTCAACCCGAAATGGCACCTACCCTGCGACCAGTA
TGAAAACTGCGGCTCCTCGCAAAAGGAACCCAACCGATACTTCCAAAGTCTTTTATGCGAAATATAATACAAACGATGCTGTAGCATTGGATATGCATTA
CTTTGGCAACTAAGGAACCAAGTTGTCCACGACGGGCACACGTTGGAAAGGGCTCAACAGCTTGAATACAAGTGGAAGATGAGTATCCGGAAGCTCAACG
CGATCGCACGGCGAGAGCGCGATAGAGACTCAACTGAAACTGAAGTCCCTGGATCTTTGTCTCCGCCTTGAAAAGGAGCTCCAGCAAAGAAAAATGCCAG
GAAGCTGCTAACTAGGGTTCAATAATACAAATGTTGTCTTACTACATGTACTTCGAAATATCTGATAAAAAATCCCGAGAAGTTAAGCCACCTCTCTCTG
GCTCGCAATATCATGGCTTTCCTCGCCCCCAGCTTGCTCTCGACATTGCAAATAATACGGCATCACCAGGTGCTTGACAAAGTTTTTCACCTCACATGTG
CGCAGGTCTTCATCCAGCACGTCCTCGTCGTAGCCGAGCTGCCAGGCGAGGTCGCGCTCGCGCGATGGGTCCGCCGCTAGCTCTTCCATTTGATCGACGA
AGCGATCAGCGTCCTCCAGATCCTTGAAAAATCCCAGCTCGGTGTTCACCTCGCGACGGCAGTGCAGCAGCCGCGCCATTTCGTGCAGATCGTACTCTGC
GTGATACTGAGTGCCCCACATAACTCCATTGAGATATCGCAGACTCACACTTTGCACCGACGTAAATGAGTTTGACGCGAGCTGCAGACCTCCCGGGTGA
ATAACTCGAACCTCATCCTTATGACTGCTAAAGGCATCAAACACCGACGGCTTGCCTTCGTACATGGGGTGAGCACGCCCTGCAGCATTCAGATGGATCT
TTCGTGCAAGTCCTAGCTCTTTACCTCGCTTGTTCTTCTGCACGACGCCACCAGCAGTAGTCACTGCTAACTGCAGTCCAAAGCAGCTACCGAACTGGGG
CACACCATGGGCAAAGCTCTGCCTGGCCAGATTCATCATCTGTACCACCGATGGGTCGTTGCGCTCGTACACCGCCAAGGACGACCCCGACCAGCCGACT
CCATGATACTGCATCACACACAAGAGTCAGACAACTCTAGCAACCTCTATCNCAGAGCATTGCAGCCTTACTTTGGACAGATCTGGCGCGACNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGATTGGTGGAGCGAGCGTCCTGGAGCGAAGATGACAGGTGGCGACGCGCCATCGG
CGAATCTGCAGGGATGCGAGGGTCAAGGGTTGCAGGTGACGCACTCGAGCCACGAATCAGCGAATCAGCGGCTGGGAGCGCCGTTTTGTGGCGCTAGCCA
AGACCGGTTTTTTATCCTCCAAAGATGCTGACGTTGCACATCACTTTAGCATTCGCCAAGAGCTCCCCAACTACTTTGTAATGTTGCGCCACGCCACCGC
CCAGGTAAGAGACCCCTATACTTGGTGTCTCTTATGTTTCATTGCAACCTGCTCATGCTGCTGCTGCCGTAGATCGCAACGACCTCTCGCCAGGCCGCCA
AGATCTCTTCCCAGCGCGGATTCGCTGCGGCCGCGTACGTTGAACTTCTTTTGCGTGTGATGAATTTGAAGCTGAACTGCTGATTGATATTACTCTTATT
TGCAGACTCAAGGTGGACAACCCGTACACGGGGGAGACCTTCTGTGAGGTGGCCTACGACTCCAAGGCCGAGGCCCACGCCAAGCTCGATGCTGCCGTGA
AGGCGCAGCTCGACTGGAAAAACGTGCCGCTCAGCGAGCGCCAGGCACTGTGCAACAAGTGGATCAGCGCTCTCTCGAGCAACGCCGAGTCCATCGCCCA
CGAGATCTCGGGCATGATGGGCAAGCCCGTGCAGCAGGCGCGCAACGAGGTCAACGGAACCATTGACCGAGCCAAGTACGACGACCTGTGTCTTTATTTA
CTGCTTTATCTTGTCAAAGTGCTGACGAGAGACTGCGCGTCTGTTGTTGTGCTTGTACTCTAGGGCCCTCGTCTACATGTCGAGCGAAGCGCTGCGTGCG
GACTCGTTTCCTGAAGAGAACGGACTTTTCCGTCAGATCACACACGATCCCGTTGGCGTTGTCTACGTGATTGTAAGTGTCTGGCTAGGATTCCCTTTAA
TGATTTCACTATTGTAGTCGATGCTAATGTCTTGCATCCAACCGATAGGCTCCATGGAACTATCCTCTTATGACGGCAGTCAACTCGATTATCCCGGCTG
TGCTGGCGGGCAACTCGGTGCTGCTGAAACACTCGCCCCGAACTCCTCTGTGCGGCGGGCATTACCAAAAGACGTTTGAGCAAGCGGGTTTCCCGAAGAA
TGTGCTTCAGGCATCATTTGTTGAGCATGACACGGCGTCGGAGATCATGCAGCGTCCAGAGACCGCATTCGTGTCGTTCACGGGTTCTGTCCGGGGGTAC
GTTTGCTTTGCGTTTTGAGTGTGGACAAGAATGCCCTGTCAGTTGATTAACATCCGCTATACGTGCAAATTGCAGTGGTCGCCAAGTCCAGCAGGTGCTG
TCCCAGCGCTCTATCGACGTGACCTTGGAACTTGGTGGCAACGTGAGTGAAAACCATTGCTCTTTGCTATTGTGCATCTGCATTCGTAGCTAACTGGTGT
TTTGTAGGACGCTGGATACGTGACCGCTGATGCGGACGCTGTGGCTGCCGCAGAGGGTTTGGTGGATGGTGTGTGCTATAACGCAGGCCAGTCGTGCTGC
GGCGTCGAGCGGATCTACGTTCACGAGTCCAAGTACGACCAGTTTTTGGAAAAGGCCAAGAGCTTATTCGAAGCGTACAACCTGGGCGACCCGACGGACT
CAAAGACGTCGCTGGGCCCCATGGCGCTTCCTACCGCACCGGAGATGTTTGACGCCCACGTGAAGGATGCTGTGGCGAAGGGTGCTCTAAAGCTGACGGG
TAATGGAATTGTTACCGATGCTGCCGGAAAGGGCCGCTTCTACTCGCCCACACTGCTTGCTGGCTGCGATGGCTCCATGAACATCATGACGGAGGAGTCT
TTCGGCCCGATCGTCGGTGTGGAACGAGTTTCGTCGGACGCCGAGGCCATCCAGAAAATTAACGACAGCAAGTATGGCCTGACAGCATCAGTGTTTTCTT
CGGACCGAGACCACGCCATGGCTCTGGGCTCGCAGATCAGTGCTGGCACTGTGTACATGAACCGATGCGATGTGCTCGACCCTTACCTCCCCTGGACTGG
CACGCGCGACTCCGGCAAGGGTATCAGCCTCTCCAAGCACGGATTCCGTGGTGTCACGAAGCTTAAATCGGTGAGTGTGTCTGAGTTGTTTTTACTTCGT
GAAGTTCACACTGACATTGACCCGTCACGCTTGCTTGTTTTGTTTGCAGTGGAACTTTCGCGTCTAGAGGACGGACACACAATTAGGTGGAGTAGATCTG
CCATCATAGTTAGTGTTGCCTTGGTAGCAGTATTCGTTTCTGCGTAAAACCAATTGATTCACCTTTGCTCTAATCATGATCGAGTATCACACTCATTCGA
CTCGCTCACAACACCAGACCGATTAAATCGGGTTACTACCTTATGAAATGTTGAAAACGAATTTGTGCTGCTATGCTTTTCATTTTTGTGGCATCTTCTA
CGTTTATGGACACCGTACCTGATCTCAAGGACAAAGTCGGTCTTCTCGTCTTCAAACTCAACGTGAAATCATCGAACATGCCAAAAGCAGGATATTTGTG
TGTTAGAAATTCGTTGTCTCTACTGCCTTTCTTAACATCAACACGGAAGTAACCGTTCCCGCAGCTTACACCTCGCTAGGTCCTCCGAAGGGGTCCACGC
GGCCCTCGCTCGTCACGTAGGCCGACGTAATACCACCGTCAACCACAAACGACGTGCCGGTGATGTACGACGCGTCGTCGCTAGCAAGGAAGAGCGCGGC
CTTGGCCATCTCGGCGGCCTCGCCGAAGCGGCCCATAGGCACGTGCACCAGCCGGCGCTGCTTCTTCTCCTCCGTATCGAGGAACTTCTGCAGCAGCTCC
GTGTTCAGTGGACCGGGGCACAGCGCGTTCACACGGATGTTCTCGCGAGCGTGGATGGTGGCGAGTTCACGGGACATGGCGATCACCGCGCCCTTGCTGG
ACGTGTAGGCGAGCTGGGGCGTTGCCGCACCAAGGATACCCACGAACGAGGCCGTGTTGATGATGGATCCACCGCCCGCGCGACGCATGGCCGGGATGCC
ATACTTGCAGCCAAGGAAGACGCCCTTGACGTTGATGTTCATGGTGAGGTCCCACACGTCCTCCTGCGTGGCGATGGCGTCGTCGTCGGCGCTGTGCATG
ATGCCGGCGTTGTTGAAGAGCACGTTGAGGCCGCCAAACTCCTTCTCGGCCAGGTTCACCATGTTCTCCACGTCGCCGGCCTTGGACACGTCCGCCTGGA
CGGCCACGGCCACCGCGTCAGTCTTGCCCAGCTTCCGGAGCTCCTCGTGCACGAGCTGCACGGTCTCCGCGGCGGCGTCTGCGTTCACGTCGGCGCATAC
GACGCCCTTGGCGCCCTGCTTGGCGAACAGGATGGCGGACTTGCGGCCAATGCCGCCGGCCGCGCCCGTGATCACGGCCACTTGGCCGGCTAGTCGACTT
CCGATGACGCTCATGGTGGAGGTGGAGGTGGTGGTGGCTGCTACGTACGAAGCACTTGAGATACTGAAGCGTTTCGGACGGGATCCGCTGGCTGCAGTCC
CCAGACGGAGTGTGCTACACTATTTTCAGATGTGCCACGTCGCCGGCCGTCACTCCGAGGGTGAGTGAAGAGATCCAGCGCTGAGGATGAGGTTCAAGCT
CAAGCACGGCTTGCTGCGTGCTGGTGCTCGCACGGAGACCAGGCGAGTGCTCGGATTGGAAGCACCGGCCGTCACCGAGCGAGCGTCCTGCTTTTGACGA
GTTTTGCTCAAAAAGCATGGTCAAGGCAAGGCAACTTCGTCTAAAATTGGGCGAGCGGAACTTATTTATCTGCCATCAAGTTTCCCCTTCGAGAACGCTG
CTATCTCAGTGTTGCTCATTGCCCTCCAAGCACCATTGTGATGCGCTCCGGACGTCGCTTCGTGCCGGTGCGGAAGTGAAGATGCTCTGCCGCATTTACC
CGTGTGTACACACTGTGGTAACGATGTTGCCGAGGACACGAGGCCTTCGGTCTGTGCTGTATATAGTCTGCTTTGCACCTACAAATGTTTCCAATATAGG
TAACGAAAGAGCTCTTCATATAAATGAATGCTGAAAAGAGTCGATACATGTAGTCATAGAGAATCTGTGTCCAGGCGAGCTGAAGCAGAGATTCGTCAAC
TGTCTCCGAGTAGATGAGCCGATTAGAATGTATTTTCGCCCCAGCGAGCTCACGTTTGAGCCCAGTTACAGCTCGCAACGGCGAGCATTTGTCAAAATCT
AGGGTGATCAACCCCACCTTCAGCAATTCAGCTCGGACTTACTGTAGAAAGGGTTTTCACCACTCGCAGTGATCCATTTACTGCAGCATCTTTGCCGACA
TTGCTCAAAACGTGTTGGATCCAGGTCAGTCTATGGATAGACCCAACCAGCTCGGGGCTCTGCAAGCGTGAGTCAGGCGGCCACGCCTTGCGCCAGCGAT
GTGAAGCAACTGGTTTCTAACGATGGATGTTTGGCTGACGGTCGATCAGCACAAACTTGGTCACCAAACCGAGGCGATCACGTAGTCAACGCGTGCATTC
ATGCAGGACTATTCCAGTGATGCGTCTGCAAAGGCAAGGACGAAGGCGTGACTCCGTTGTCGTCGGCAGCTTGATGCTGCACGTGTGCCGGCACCGGACC
GCAACCTGAAAACGACGCATCCCTCCGCGCCACAAACTGCACATTTTCACCACCGACCAGGGAGGATGGGCACTTCAAGTTGCGCAAACTACCGAAACTT
GTGTGCACCACTCCACTCCAGTAATCAGGTCAAAGCTCGTCGACGTCATTCGCTCAACTTCCTCGCTACGACCGAAGCCTCCCTCCGCCATGTTGACCCG
ATTCCCCCAGCGCTTGCGTCTACGTCTGCAATCGACAGACGCCTCGCGCGCACTGAGTTCGGCCGCTTCCTCGTCCTCTTCGTTGAAAGTTCTGATCATC
GACGGATATTCGCCCGATGGCCGCGCAGACCTGGAGGCTGGTGGCGCCAGCACGGCCGGCAAGCTGTACGTCAATCTGTTGAACAAGTCGGCGCCTGCTG
GAATGAAAGTCGCGTCGGATATCGTGTACCCAGCAGACAGCGATTTCAAAACGCCCGAACTATCCAAGGTGAGCTGACCGCTTGAATCTTCATCATTTCG
TTGAGATTGTGGCAAGAAAAACTGGCCAAATTGTGGAATGCTCAGAGGGTTATTGAGCGAAGAATTGATTAAACGTTGCGTGTTCGTTGACAGTACCATG
CAGTGGCGTGGACAGGATGCTCGCTGACAATTCATGATACCAAGGACGTCCGTGTTACCAAGCAGATCGACTTCGCCCAGAAGATCTTCGAGAAAGGTGA
GGGTTCAATGGACGCAGTGGAGGGGTCTTTATCATGATTAAAACAAGGCACTAATGTAGAGTTACATGCTGTTACTAGGCATCCCGCAGTACGGTAGCTG
CTGGGCGGCGCAGATCGCGGTGGCTGCTGCCGGAGGTTACTGCGGGCCGAACCCGCGTGGTCGTGAGATGGGCCTTGCTCGTAAGATTGCACTGTCCCCC
GAGGGTCGTGCACACCCGATGTTCGAGGGCAAACCGTCGGTTTTTGATGCATTCACTAGTCACAACGACGAGGTGACCCACATGCCTCCCGGCGGACTTG
CGCTGGGTGGCAACGACTTCACGGCGGTACAGGCCGTGGCTGTGCGTCACAAGCAAGGAGAATTCTGGGGCATTCAGTACCATGCTGAATATGATTTGCA
CGAGCTCGCAAGGCTCACGTACTGCCGCAGAGAGAAGCTTGTGGGTCTGGGTTTCTTTTCCGACATGAAGAGCGCTGACCAATATGTGGACGACCTTGAG
AATCTGCACATCGATCCGTCTCGTTTCGACATTGCGTGGCGCCTTGGAATAGATGCCGACGTCATGGACGAAAACATCCGCCACTGTGAGACGCGCAACT
TCATCAAGTACCTTGCGCTTCCCTACAAGGCGGTTGTCGAGGGTAAATAGGCACCGTTAAACCGCATTATTGCATTGTATCGCGATACAAGGAGGTAATA
GATGGTCAAGTGCTCACAACTTTAATCGTCGATGGAGATTATTGATAACCAGTCGCTTTCAAAAGTTCTCAAATCGCTTTGTATTAGCTCGCATTGGCAA
CAAGAGAGGATATAACCCCTCATTCCGGCTGCTTATGTAGAAATTTGCTGGGTGCATGCGTTGCCTTGGTTCTGGCAATAGCTTTCAGAGCTTTGTAGTG
AGATACTAAAGGCGCAATCTTCACATCAGGATGCTACAAGCTTAGTGTCGTCGATATTGTGGCGATTACTTTGAAGTACTTTTAAGTGCACTACACTATA
GTACTGCATGTACATGTAGTAGGAAGTAAAGACCCGGTGCCACAATAAAACTGCTACTGGTACGAATCTTGAACGTCCAGCGCATTTGAGCTTTAATTCG
TAAGTCCGCCTGCCACCGCTCAGCGCTCCAAGTCGTATGCGCCGAGTGTCAGCTCTCAAGATTCATTGCGTGAGTTGCAGTGAAGTCTCAAAAGCTTTTG
CTGTTTTCTTTCGCTCTTTGCAACAACTTCGCAAGCACCGGTACTCCATGCAGTAGTTTTCAGTTTCGTAAATGACAAGCTAAGAAATCATTGTTCAGTG
GTTAACACGTTGAACGAAAATGCACGTGGATAAATGCAAAATGCAGAAAAGCTAACTTGCTACCCACAGAAACCACAGAGAGACGAGACGAACGTCAAGC
GCAATCAAAACGTGTTGTAAAGACGTCGAGATCTCGCCTGGCCCCGTTATCTACAGCGTACGCTTACTGCTTGCCGCTTTTCTTCTTGGCAGCCTTCTGC
ATCTTGACGGCCTGCACATTCACCTTGACATCGCGGGTGAAGGGCAGGTAGGTGACGCCGCCCATGAAGGGGACCAGCACCTCCGGGACCTTGACACCGT
TCTCGTCCTGGCAGTTCTCTAGAATGCAGCACACTGTACGCGTGGAAGCGCACAACGTCGAGTTCAGCATGTGCACATACTTCTTCTCGCGCTGGTTCTC
CTTCTTGACGCCGCAACGAATCTCCATGGCACGCGCCTGGAAGTCCGTGCAGTTCGAGGCCGACACCAGCTCACGGTACTCCTTGTAGGCAGGGAACCAC
GCCTCCAGGTCGTACTTCTTGACAGCAGCGTTGTTAAGCTCGCCCGACACGATGTTCACCACGCGGTACGGCAGGTTCAGCGACTGGTAGAACTCCTCGG
CATGACGCAGCATCTCGTCGTGCATGGCAGCAGAGCTCTCCGGGTCCGTGATGCAGAACTGCTCCATCTTGTCGAACTGATGCACACGGAAGATACCCCA
CGTATCCTTGCCGTGCGATCCAGCCTCTTTACGGAAGCAGGTGGAGAAGCCACCGTAGCGCAGAGGCAGCGAGCTCTCGGTGATCCACTCGCCCTTGTGA
TAGCCGCAGATGGGCTGCTCGGACGTGGCAATCAGGTACTTCTCGTCCTCCCCGATGACCTTGTACAGCTGCTCGTCAAAGTCGTCGAGCTGCGCGACAG
CGGCCATGCACTCCTTGTTCATGAAGAAAGGCGGCTTGAGCATCTTGTACTGGGCCTTCATAAGGAAGGCCGTGGCGTAGGCCATGAGCGCCTGCTCCAG
CAGGAAGCCGTAGCCCGTGAGGAAATAGGCGCGGTGTCCAGCCACCTGCACGCCGCGTTCGGGCTCGTAGCCATCGATGCGATGCAGCACCTCGTGGTGG
AAGTGCAGGCCGTCCTTCTGGATGGGGGATCCCCACTTCTTGACCACCACGTTCTCATCCTCGTTGCTCGAGACGGGCACAGTGGGGTCCACCACGTTGC
CGATCTTGGGCAGCTCGCGGTCCAGGAGCAACTTGAGCTCGTCAGCCTCCTTCCTCTTCTCGGGCAGCTGGGCAGCCAGATCCTTGCGCTCGTCGCTGAG
GGGCTTGAAGTCCTGCTTGGCCTTGCTGAGCTTCTTGATCTCCTGCTGCAGCGCGTTCATCTGCATGCTGATGGTCTCCACCTCGCCCTGCTTCTTGCGC
CACTGCTCGTCCAGCTCGATCACCTTGTTCACGATGTCCACATCTAGGAAGCGCTTCTGCTGGTCGGCGCGCACGGCGTCCGGGTCGCCGCCACGCTCGG
GACGCAGGCGGTTGATGTCGATAGGCATGTTGGAGTGCTTGGCTGAGGGTGCGTTGCTTTTCCACGTATGAGAGCGGGGGCCATCGAAGCGAAGATTCGC
TCCAGCCACAGGAATAATCCTGGTCGGGCCTGAAAATGTGTAGTCGGTGGCGCATTAAGTAGCAACTAATCAGAGGCGGATATTCTTATATAACGTTTAA
AACTATGAAGTATTATGTTTTTACTTTAAAAAAATATAATAAACGGTGAGAAAGTCGAAAGCGTGCGTTGTGAGGGACAAACTAATTTCCAGCACCTGGC
ACTGTCGTCGTCGCCACCCGACGAACCTGCGCCATCCTCGGAGACATTACCGGTTAGACCCTGCTTACCTAGTCTTCGCGGCAGTAGTTTTGCTTTGATG
CGTCTATATTGAATATGTGCGGGTTGCTTGCTTTCCCTGCTGAGAGCCCTCGGTTAAAAATATTGTTTTGTCGTAGCAAGAAGCAACCTGGATTCATAAA
ACCACTTCAAAGTTTCATCATTGCTTGCATATCGGCTGTTGCTACGGAGATCGTCATAGCAGCGTGCCTCGTTGGTGGTGGCGCTCCTGCGTGGCGGCGA
AACGATCCACAACTGTGTTGGCGTTCGTGGCGCCTTTCGTTAGTGTGGCCAGGTACGAAACCAACAGAGCGTCGTTGTACTCTTGCGTGAACGCCGCGTC
GAAATGCTCCGACTTCATGGCGGGCAGCTGATTGCAAATGCTCGAGATGTGGCGCAGCAAGTTGTGGTCTAGCGGGGCCTCGCCATCTTTCATGGCCTGC
AAGAAGCGCAGCAGCACGTCAACCTGACGGTCCAGCATCTTTACAGCGTCTCGGACGTTGCCCAGGTACGGGTGCACTGAAGCAGCGGCAGCGAACGTTA
GGTTAGAATGAATGCCACATCCAAACAAATATCCTGAAGACGATGCACTTACACGACGACTTGCTCGCATCGCCAATCGGTGCGATCTTGGAAATGTGGT
CGATGGCGATACCTTCGGCTTCGGAGGTATCGATTTTGAAAGGCGCCTTGACAAAGATCATCTTGGGCACGCCGTTCAGCATGTGCAGCTCCGACTCGAA
TAGCGAGATCGGCAGCTTCTTCTTGGTGCTCGGCCCCTTGGCCTCGGGGTCTAAGATCATGAACAGCGGGCTCTCATTGAATTCCATCACCTGTACGATA
ACCAAATACCTGTCAGGCCAACCTTCACCATCTCTACCAACCCACACGCCCTTCTCACCACGCGATGCACCGCCAGATCACTGGGCAGAGCCTTAGCGCC
CACCGTGTACCACCCTAGCAGCTCAAAGCCCGGGAAAACCTGAGAAACTGCAGCACCGCAAAACCCCGCGTCAGTTGCGCAGTCTCCTTCCTCTTAGCGT
CTCCACGTCGTACATTGCTGAATGCGCGAAGTGAGGAACTCCTTGTCGATCTGAATCTCTCCACTGGCGCCCACATCAAACTTCATCTCGAACGAGTCGT
ATACGTCCACGTCCAGCCCCTTCTGGATACCGAAGAGCGCGCCGATGACCTGCGGCGCCTCCGTCTGGCTCAGCTGCGAGTTGCACTTCTGCCGGGTCTG
GTGGTCGGCGATGTTCACGATCACCAGCGGGTGGATCTGGATTTGCCGCTCGCCTCCGCCAGCGCCGCTGTCCTCGCGCTGCACCAGCATCTCCTCGTCC
TTCTCCTCTGCGCTCGCCATCTCCGTGTCCTCGCGCTGCATCTCCTTCTCGTGTTGATGTGTGTCGACGATCCTTGGTGTAACGTGGTGTGTTCACAAAT
TCGGTGACTTGACTGTTGTTGTGGTGTACGCTATATGGTGGCAACAGTTGGACCGTGCCTCTAAATGATGTACGATTTGTGTTCATACGTTTTTGCACTC
AATTGCCGACATGACGGCACTGAATAGTCAGTGACTATTCCGGTAACGCTCAAGCTCGTTGAACAGGCCCTCAAGAAACGCAGTGCCGCGCTGAACCAAA
TCCCCCCTCCGTTGCAGCATCGGAACAACGCAAACCGCCGCCGGGGGCCGCCGCCAACATGAGCGACCAAGTGTCCGACGACTTCATCTGGTCCTTGGAC
GTACGCGACGACCCGAGAGGCAGGAAATTGATACATGACTGACATCTTCTGCGTCCGTTATATGTTGCTCAGAGCCTGATAAAGAAGGATGCGGGCGCCG
ACGTGGAGGGCGACGCGGACCTCGTGCGCGCAAGCTTGTACACGCAGGACAACCTGCTGGGCTCCATGATCGGCAGTGACCTGGTATTCGGGCGTCGAGA
ATCCGCCAAGTTTGCGCAGGATGAGGACGTCGCAATGGGAGGCTTCGGACGGCCCACGGGCCTCATGGGCTACGGTATCAACGAGGACGAACTGGATGAT
GACGAGACAATCGGCCCGATTGAGGAGCGCCTCCCAGCCAACTTGAGCGCCACGCAGCCAAGCAGCGGCAGCAGTTATTACGCCCGACAGTCCTCCAGTC
AGCTCAGTGAAGACACAGATAGGTCCTTTTCGTTCGCATCGGAGGATGACCACGGCATGGACCCTCTGTCCCTACCTTCACCGCAGAGGAAACGTTCCAC
GAGACGATTGAGCGACGGAGATCAGGATACCTATGAACAGCGAATCGAGGCGTCCCTGGCTGGGTACATTACCAAGTCGCTGAACATCGAGTCGCGCATG
GCCGCAGAGGAGCAACTGGATCGACCATTTACAATGAGCGACCTTGCTCATTTCAGTCCGCAGTTCGGGCGAGAGCTGTATCTCGAACGACTAGGGCAGA
GTCTGCAGGAGCAAGAAAGTGGAGGAAAATCGCTGGCTTCGTACCGACGAGCCTCCATGCAGCGGATGTCCACACCAGCAGATATTATTCGGCAAGGATG
GATCATGAAACGCGGAGAAGTGGTCCCTAGTTACCGGAAGCGCTGGTTCACGCTGCGTCGGATGCCGCAGGGACCGATGCTAACGTACGCCAAAGACAAC
AATGAGACCTCTCCAGCTAAAATGATTGATCTTAGCTCAACGTCGCGCTGCGTGACTGTCACCGGCAGGAACGCAAAGGAGCACGAATTCAAGGTAATGA
CATCTGCGGATTCCTCGAGGCGTGAATACTGCATGGTGGCAGCTTCCAGCTACGAGATGACGCAGTGGGTGTGCGCTATTCAAGCTGCCATCAGTGCCGG
AAACAGTTCTACGTTTGACGGCGCCACAGACTTCAAACAGCTATGGCACGAAGCTGGAATCCAAGGATTTTTGGTTCGATACGGTGTGCGCAAGTGTAGC
TCGCGGAATCGTCTTCAAACACGAGTCCTCGAGCTTAATTTTGCAGAACAAACCCTTACAAACTCGCGACGAGGAGAGACCCTCACGACATTTCATTTCA
CTGATATTCGCGGCATTTCAGTAAGTAGTGTGCGCTCTAGCGGCGAGGAGCATGGTGTCAGTATCGATTTCCACGGACGGCATCGATCCTGGCCAATTTT
CTTGGATTCGGTGGAGGCTCGAGATGATTTGTTTGGTATTCTGCAGCGTATTGTTGGCAATGTGGTGTCGGGCGAGGACCTTGAAAAGCGGTCGTCTCGG
TTGACGCTCAAGACTGGTCACCTCGAAACAAAAAATGCTGGGCCCCACGCTACGCTGCGCGGTCGTTTATTTGTCTGCCTTCACGAAAACTGTATCGTGT
TTTATCCGGAAGATGGAGATACCAGTACACGGCCGTGGTATGTCATTGCCCTTAAGGGCCTTCGCGTTTCGGTTCGAGAAGAAAAGCGAATACTTTATAT
TGGACGGCTATCGTTAGCGTGCTCGTCCACAGCAGACTGTCGTGCCTGGTATGATGCCATCTTAGCGGCTACGTGCCTACCAGCAGAAATTATTGAAATC
GAGCTAAAGGAGCGAGCGAAGATCCGCACCGTTTTCCAGGTGTGTGTGTCTCGGCTGCGGAAATTGCTCAAGGCTAAAGTGACGCCCGAATCGAATGGAC
CACCGAAAGATCAGAAGACGGTGACTTTGTTGATCAGCAAGCTCTGGGAGCTCGTTTTCCCGGGAGAACCTTTCACGTCAAATGCCGATCCCAAGTGGTT
GGAGATTGGTTTTCAAAGAGGTGGCCCTGCGTCTGATCTTCGTTCAAGCGGTCTTCTTGGACTCTACTGCCTAATCTTCTTTGCCAGCTATCCGTCGAGC
GAATTTCAACGTATCCTGAAGCGCACACGGCATGGTGTGAGTGAAGGTAACATGAAGAATTACCCTCTGGCGATTGCGTGCATCAATGTGGCATCGCTTT
TGACCGAAACGCTTGGTTTGGGCGACGCTGGAACGCACTCGGACGGTTGTTCGTTAAACGCGATGAAGACATACAGCCTTTTGGTTGCACAGAGTGTCAG
TAAGTCGAGGTCTTCAAAACCAGCAAGGGTGTTTTCGACGTCGCGGCCGCTAAGTGCTTACGAATCCTGGGAGGAAATTGTCGACGAACCGGAGAACCAC
GTGTTTGAGACCATCTTCAGCCTTCTCTTCCCGGTTCTAGACTCGCTTTTCGTTGAAATGGGAGCGGTAAGTTTGTACCTCGGTGCGTGAAAGGTGATGT
ACAAGCTGACGGTGCTGTTTGTTTGCTACAGGGGTACATGGAATTCGGTCAAGTCACCATCGCGTTCCGACAGCGCGTGAATGAGATTTTCAACGCGCAG
CCCAAGTCACTGAAGGAGCTTCAGAAGCTGGCGAGCGAGCCTTGCACGGGCACACTAGCGGTGCCGACGGTGTTGCAAAGTAAGCATCACAAGATAGGGA
AGATTGGCTTGGGCAAGAAAATAGTGAGGGCGGGCGGCGTATAGCTACGACGAATGCAGTCTAGTCTTGCCACCCCACATAGAGATTTTGAAACAAAGCC
AATAGAAATGCCATCCACTTTGCGCGTTGAAGATGCATTGAAATGAGTTCCCGACAACTTACAGTATAGCATAAACTTCACGTGACCACAGTCGTGGGTC
AGGACGCTCCACCCCACACTCCGATAGATGCGGCGCTGCCACCAACGCTATTTGCTCGCGGTAGCTGAACTGGTGGAGGAGTACGATGCAGATGCAAATG
CCGACCCCTTCCGCCACCACGAGCACCACCTCCTGATCCACTGCCCCGTCCATAGTGGTGGTGGCGAGGTGGCTGATGGTGCCCAGATCCTCCATGATTC
ACGGCCGAGCGGGCCAAGAAGCGTTCCCACGACAGCTTCATCTCACGCAGAAGCTGTACTGATTGCTCTTTTGCACGGCCCAAAGCCTACACAAGAATTT
CAACATGTCTGATTAGAAATTCTCGAGACCTCTCAAAAACGAGAATCCTTACCGATTCCGATGTGCTGGTAATCTGAATGTAAGCTTCTGGCATCGTATG
CGAAGAAATCTCCTTTTTGCCGTCACCCCGACCTTTGCTCCACTTGGCTAGCGACTGTGGCCACGGTCCAAAGTAACGCAACTGGGCACATGCAATAGCT
TCGATCTTTTTCAGGTGGATGCCGCGCTCGCCGAGCAACTTTCCCGGGAAGTTAAACCGCCGTGACACGAGCGCCTCCGCGTCGACAATGTCATACACAT
TCACGCGTGCAAAGAGGTGGCCAGAGGAAACAGACTCCTCGCCATCACCACTCAGCACAGCGTGCTTAAAGCTGCTGCTTCCGCTGCTTTCGCTATCATC
TTGACCCATTTCATCTTGTTCCAGGGCTGAGAGTCCAAGCTTCTTCATTTGCCGTCCTCTTTCTTCTAGCACTTTGCCTTCCTCTTCCTTTCCTTGAAGC
CGTAGGCATTTTCCGATTTGTTCTAGTTTCCACGAAGTAAAAGCGTCAATTAATATGACGACAAGTGCATGCTGGCTCACGAATTCGTACCAATACAAAA
ACCAACGTCACGTGTATCTGGGAAAAGTTGCTGACGAATGTCTTGTGCTTTTTTGTAGGCAGCAATAGCTTCACCATAGCGTTTCTATCAACAATCGCAT
GTCAATAATCAAACAAAACTGTCGGCTTAATCCACTGCCATACCTGATCCCGATACACACGCGCGAGATTAATAGAGATTCGTGCTGCACGGGGGCTGAT
GTCATTGAAGTATCGATCCGTGATCTGCAGGGCTTCCTTAATGTTTTCTTCTGCTCCACGCCAATCTTTCTGTTTCCGAGAGAAAAGTTGTAAGAAAGCG
GCCACATGCAGAATAATCGAGTTGGTAAACGAGACATACCGCTAGCCGCTTGAAATTGCCCATGTTGTTCAGTGTAGCAGCGGTCTCAAAGCTCGCATTT
CCGAGTCTGCTCCGGCGAATTCGGAGTGCTCGGTTGTACAGACGACCAATTTCTGCTCGCTGTGCTGCTAGCTCCACCTCGCTGACAACAGCAAACAAGC
GTTAGATTGACATGACTGGGGTTTTCGGGGCAATTGATTTGACATACCTCAAGTGCTGGGTTTCAAGTTGGTTCGAAAGATAGAGCGCCAGGTTGTTCAG
CGACTGAGCAACTTGAGGATGATTCTCACCAAGCGTTATCTCTCGTATCTTGAGGGATTGACGATACATGCCAGCGATGTCGGGCCGTGCCTCTTCCTCC
CCAGTTGTAGTACTCTTGTTCACACCCGTGGTGACACTCTCCTGGCTAGGGCTTGTCACACTTTCGCTGCTTGTACTAGATCTACTTGGGCTCGGACTAG
AGCCAGAACGAGCACCTCGGTGAGCAGTGTCATTTCGCCGCCCACCGCTTTTTCCTCCCCTCATGAGCTTTTCTCTCGATTCACGAGCATCCTCACGCAG
TGCCGCCGACGGTGATCGACGTTTACCGGCGGTTGGATAGTTCTTGTAAAAGTTCGCTAAGTTGTTCAGGCTCGTAGCGTACTCTGGATGATTTTTACTT
AGCACCCGACTACGCATCTCAAGCGCCCCTTTCAGCAAGCGCTCAGCGTGCTGCAGCAACCAAACATTATGTGCAAGATACCCCCAGCGCGTGCTGAGAC
AATTGCCAAACTGATTAAGCACTTCAGCCACCTGCGGATGTTCCGACCAGCCCAGTACCTCTCGTTGCAGCCGCAGCGATTCAAGATAATGGTACTCTCC
TGCAACCCAGTCGGTGACATCGCAACAGGCGTAGCCCAAGTCAGTAAGTAGAAGAGCTTCTAGTGCAATGAGCTCACGTATTCCAACACAAGTACAGCGA
TCATGTGCTGCAGCAGCAGCGACGGGAGGCTGTGGTTCCTCGAATGAAGGCAATTTGTCCAGCAGCGACAGCTCTCGATCATACTTAGCTTCTTCCACAT
CCCACAACAATGCTGCAGGATCATTTTCACGGTTCCCACATGTACAATGTAGCGAACGTGTCTCCCGTGAGAGCTGCAAACAGGAAGATACCACTTGAAT
ACGCCGTCGTGGTTCCACACGCGCGCGAAAAATGAAGCGACACCGAACAACTAGATTACTGTACAGAAGCCCGTCCACAATCGAGGAATTTGTGAGCGCT
GCAGCACCTGCAGACCGGCGGCTACTCCCGGTACTGCTGCTTGTACTTGCACCAAAGCTACTGCTGTGGCGCTCAATGGATGGGTTGGGCGTTAATGCAT
CATCTGTGTACAATGCTGGCTCACTTTTTGATCTCATAGTACTGGTGGAGTTTACAGGAACTTCACCAAGCTGATCACTAACAAGCTCTTGTTGTGTACG
ACGATTGCTCTCACGCACCTGCTCAATGCTCTGTGACGTGAGCTCATGAGCTAACCGCATCGCCGATTCAATATTAGCACGTTCCTTATCGAACAGCGCC
AACGTGCCCTCAAAGCGGTAGGCATGTGAAGCCTTAGCCACGATCATGCAGTAATA