Description :
From Genome Similarity Track
Location :
Scaffold_200:5107- 7854
Transcript NameFunction/comments
Phyta_totarag5469conserved hypothetical protein
Phyta_totarag5470hypothetical protein

Sequence
2747 bases(100 bases per row)
TCCCCATTACGCTGGCTACGCTGCCCTACGTCAAGCGTGTCTTCTCCCGCAACAaagtggaggaggccaagtaACATGGACACAACGCAAAGGTTGGTCT
AGAGGAGTGAAAGCGACTTCCAGGTCATAGAATTGGGTGCGTGTTAGATCATGCCTTGAGAAGGACGGAGTGTTGCTTAGTCTGAGCTCTGTGCTACAGC
GGTGAGGTTACCCTAGCTTCCACTGGAAAATCGACCGGTCGTTTCCTCCAACTGAGATCAGATACTTGTCGTCAAAGCTGAAGCGCACGTTAGCAACGTG
GGAGGAATGACCTCGACGCGTGACGAACTTTGACTACAAATACAAGAGTAAAGCAATGTTAGGTGCATGCACGACACGCAAAGTCTTCGTCATTAGCTAG
ACTAGGACGTACCCCTTTTGGAATGCATGGATAGCGGAAAAACTTCACGTTGCCAGAATCGTCTCCGGATGCGAGGATTGTACGTGATGAAGACGCACAA
ACAGCATTGATGTCCGTACCGTCGGCACAATCAGGCCAAATACCTTGTACGGGCCAGCCAAGCGTGCATGTCCACGTTGCCCATTTCACATCCCGCACAG
ACGACGCTCGGCTAACTTGACTACTCGAAGCCGTATCGCAGAACAGGTACTCATAAGCACCACAGTTTGACTGTATGTAGTTGCTGTCTTCCGAGAAATC
AAAGTGCGTGATGTAGCTGTTGTGCTTGCTAAACGGCTTTCGCTTCTTGAATTCAGATGCCCCAGAGCCaacagtgtacatgtagatcgaATTGTCGTGG
GAACCAAGTGCCAACATATCTCCACTAGGCGAGAACTTGACATCACTGATCCATTCCTTCGCTGGTTTATCTTCAAACATCATTTTTTCTGTATCCAGAT
CACGTGCTCGCCAGACAGCAAAACCTCCTTCTCTCGATTGTGTCGGTCCTTGCTTGGGCGCCGCTTTTCGTCTCTGTCGTACACCATTGTCTCCGCCAAA
GCCAACTGCTAGAAGCTCGGAATCTGGCGAGTATGCACAGGCACGAGCTTTTGCAGGGAGTAATCGCGCCTGAATCAATCGCTTTGATTCCATATCCCAC
ACACGCAATGTTCGATCGTCACCGACCGTCATAAATTCTCGCTGAGAGGGATGCACAGCTAGTCCCCAAAGCTCCATGGCAAAATGGCCGGAGAATAGCG
GTTGACCGCCATTCAGAACACCACCACTGGTAGCATCTATCTCAATGATGTCGCTGGAGCAAGTACCGACAAGAAGTTTCCTGTCTGTGGAGTTTAGAAA
CACGCTGTTGATGATTTTACCAAAGCTTCCAATATGCATTGCCTCCAGATCAAAACATTTTAGCGACTGGTAAGCAGTGTTCCACATCACAACACGGCCA
TCTTTTCCGCCTGACAACAGCACGGGGGAGTTTAAAGAAGCATTTTCAGTTGAGCTGGTACTATACACGACTCGGACTTCACCTTTGTGCGCCTTCACCG
TTTTAGAAAGATCATTTCCTCTCCAAACATACAGCTCGCCACCTGCAGTCCCGGTCACAAAATCCCCTCCAAAGTTACATCCTGTCGGAAACGTTTGCAA
ACTACCCTTCTTCCCCACTATCCCCTTCTTGGATAGAATAGTTTTGCCCTGGACAGACCAAAACAACACGTGCTTCACGCCGCCAGTGATAATAGTATCT
GCATTCGTTCCAAAAGAAGCAAAACGATTTACCGCTTTATCGCCTTTACCTGTAGCCAAGAGCTTTGCCAAAGTCCATGATCCATTGCTTGCATCGACCC
AAACTGCCAGCGAGtggtcatcgtcatctcccACACTAACCAACCTCGTCGAGTCACTGCTGAAGGCAAGCGACAAGATCCCGCGCGTATGAAACTCCTT
CATTTCGCAGCGTAACTCGCCCGTGTGGGCATCCCATACTCTCAACGCCGGCTTCTTTCCACGCTCTCCTGTCGCGATAAGGTTGCGCTTGGCGTCGCAA
AGCGCAAAACTAATAATGTCGTCATTATGTCCGATGTGGTGCTTTTGCAAATGATTCGTGGGGTCGTACGTGATCCCCACCGCTGCCGTGTGATAAACGA
TTTCGTCCTGTGCGTTGTACACCAAATTCTGTTGTGATAGCTCTGATTGATAGCCATACACCCATTCAAGCTCAACACTCAAGTCAGGTTCACGAGAGTT
GGGCGTGGCAGCGTTCGTGGGAGCAACGATTGCTCCTATCCAAGGTTTCACCGCCATGAATTCGTCTCCCACAGAGTCATCAAACGATTCCTCCTCCGAT
TCAGCAGATGAATCTGTTGCCTCCTCTGGTTCTCTTAGCCTTAATTGTTTTTCAGGTCCTCCTGCAATTCGTTCGTTCTCTCCTAAGACTCTCCACTCCA
TGACGGAACGATCATTTCCACCAATACTAATTACGTATGTATCGTCATGGGACCACCGGACGTTAGTGACGTGAGACGAATGCCCGCGGTGGTCCACTGA
GCTAGCGTTCTTTGCCACACATGGATAGCGATAAAGCTTGACGAGGCCAAAATCATCCGAGGTGGCCAAAAGGTTCTCGCGTGAATTACGGGCGACAGCA
TTTACATCAGTGCCATCGGAACAGGGCGGCCAAATACCCTGCACAGGCCACCCAAGCACGCATGTCCATGAATTCCACTGGGTATCtttcgtgctgctcg
cagaCGTGATGTGTTTGCCGGTGGTGGCATTACTAAAGAGAAGTTCG