Description :
From Genome Similarity Track
Location :
Scaffold_75:51060- 52534
Transcript NameFunction/comments
Sapdi_VS20SDRG_14603hypothetical protein

Sequence
1474 bases(100 bases per row)
ATACAGGTCGTCGATGTCCTTACCGCCATCGAGAAGGGATAGTTGCTCGCGTACAAGTCCGTGAACGGGCTCAGCGCGGTGGACGGGTCGGCGAGGTTGA
AGACACGCCACACACGGCGCGTCGACGCATCTGACGACGCTCCTGTGTATGCAAACGCCTTTGTAAAGTCAAATGGCAAAGTCGGCTCCCAAAACCCGCT
GCGCGCCGCGACATCGCGGAGGTTGGACGAGTAGAGAAAGTTGTCGGCGTCGTCAAAGTGGATTTCCCGAAGTACAAACTCGTTGGCGACAACGGCAATG
TGGGTGTCGGGCACGCGCTGGGCGGCCCAGAGCGCCGACGCGCCCGTGTCGTCGGGCAGAATGTGAAACATCCACGCCTCGACCGTGTCGGTGATCGTGA
GCGCTTCGCCAGCGCTCGCGTATGCGTCGTCCGTGCCCCAGTCCGAGCCATAGTACCTAGTCCAGCATATTTGCAAAAGCCAGCATGAGAGCGTGGACAG
TCATACCCGTACGTCTCGGCAAGACGACCCATGAGCAAAATGGCATCCCGCGCTGTCGTTGTGCGCTCGAGCGCGATGCGGCCGAGCTCGGTAATATCGA
GGAGCGCGAGCCCGCCGTCCGAGATGGGCCGCGACACGAACCGCGCACCGCACGTGCTCTCGCCCATGGCGAGCTGATGCTCGTTCATGATGCCGTACAC
GCCTTCGAGGTACCCGTACGTGGCGTTCACTTGCGGGATTTGGCCAATCGGCTGCGTGACGTTCCAGTCGTAAAAGCGGTCGTCGAGGTTCTCGGGCGAA
TAGACCGGCCCGCGATCGTCCCCGACTAGCCACGGCTGAGAACTCGAGATGGGCATCGATGAGTACCGTAGCGAGGGTACTGCGAGGTCGGAGCAAAGAT
CGGCCGCGTGTCGCCTGCTTCGTATTCCTTTGCTGGGATCTTGGCGAGGCGAAAGTCGCAGTCAGGGCAGTCGTTGCTGTGGGTCGTCATGGGCGAGCCC
GAGGTCGACGCCTGCCATGCCTTTGTAAGTCGCCACGCTCCAAGACGAGGGCGATGTGTACCTGGGCGCCGACGAGGATGGCCGTGCAGCGGTCTTTGAC
GCCTGCGACGGCGTCGAGAAGCAGCGCGGAGACGGCGAGGACGAGGCGCATGGCGTGCGACGGCGCAAGATGTCGAATGACACAACTAAGATCTTCTTCC
GCCGCGCTATCCGGATCGGAGGCGGTTACACGGCGAAACTCAAAAGCTACTTTTTCACGCTTGCACTGGGTCATTGAGAATCATTGGCACCAGAAGCGTC
GAGTGAGAATAAGCTCTGCTTGCGCTCTTCCTGCGGGTTGGTCGGCGTCGTTGACGAGTGCCATAGCAAACGTGTGGCAAATCTGACGGCAGGCTTCGCC
ACCACTCAAGTATCGAAGCCCTTGACCAGGCGCCGAGAATACTTCGGCTAAGGCGCCGCAACCGGCGGCTACTC