Description :
From Genome Similarity Track
Location :
Scaffold_227:5106- 9211
Transcript NameFunction/comments
Physo_144646reverse transcriptase

Sequence
4105 bases(100 bases per row)
GAGCATCGGCTGTGTCCGAACTGAAGGACTTCAGCGGCAAGGAACATGACGAAGAAGCCGCCCGAGCCTGGTTCAACAAGATTAGAACGGCCTTCCGACG
GGATCAGATGCAGCCAGACGAGATGTGCTTGACATTTGCCGATTTGATGATAGGCCCTGCGCGCAATTGGTATTACCAGCTGAGCCGCACCGCTCGCGCG
TCGTGGACTGACCTGGGTGAACAGTTCCAGATCCACTTTTGCGGTAAAGGGATCTCCCTCGCGCGCAAGTACTACCACATGCGGCGCGGGAGTCGGGAAG
ACCCACTGGATTACTTATACCAGCTGAATCTGGCCGGGATACGTGCAAACTTGAAGATCCATGATGGCACCAAGGAACAACGACGTGAACACGTCGACCA
CTACATCGATACAGTCCAAGATGACGATCTCGCCGGATCTCTGGTAGTGTTGAGGCTGCCTGACTCAGAAGCTCTCGAAGGCGTCCTGTTGGCCATGCGA
CGCCACCACCAACGTCGCAAGATTGAGACCCAAGGTTCGAAATACCGCCAAAAGGCTCCCGCCCTTGCAGCCTCCTCGAGGGCGGTGCGGGTTGTGACTA
CCGGTCGCGGACGCCGCGGAGATCACGAAGGTCTCAACGAGTTCGAGGGCGAATCAAACAGTTCCGATAGCGAATCTGAAGAAGAAAGAGCGCACGTGTT
TTCGGCAGCTAGGACGCCTACACAGGGAGATGGTGAACAGCCAGGGGCGCCCCCAAGACCGCGAAGACCAACTGGGGCGCCCGAAGTACGACACTCGATG
CTCACACTGCGGATCTCGCAAGCATACGGATCTCGGGTGCTGGAAGAGGCTCACGTGCCAGAAGTGTGGACGCATGGGCCATCCTACCGACAAGTGCTTC
TACGTCTGCAAGTGCTGTGGAGACGTTCACGAAGCAGGTCAGTGTAAAATCGGCGACTTCTTCGATGCTGTTTGCCAATGGTACAACCCGACTCGCCATG
CCGGACTGCTGCCCGAGAGCGTCGAGAAGGCGTTAAACTAGACCGCTCGCCAGGCCTGAACAGCCTGGTACGTGACGAGCGATCGAAGTTCTGCATTTAT
GCATATGTTCAGAGGAAGGCGCGAGCGTTAGAAGACCCAACTTCCTGTAATGCGGTGAATACAGCCAGATCTCTTACCTCGGATGAAGATGACTATTCGC
GTCGCCCTTGTGTGATGGCCCTTCGACTGTCGCCGGGTGAACGCCGAGGTTACTGGAAGTATTACACTCCCTCCAAGTGGTTCAAGCAGTCGAAGGCGAC
CGGTGCGGTCAACAATGTCCGCGCCGTCCTACTCTTTGATACTGGAGCCGAAGTGTCGATAATCGACTCTACCTTTGCACGTAAGGTGGGTTGTGAAATT
GATACAACACAGACAATGGATTGTGTTGGTGTGGGGGATGTTGTGTACCGCACAGAAGGCCGAGCAGAAGTCAAGCTCACACTGGCTGGAGAGTTGGTGT
ACAAGTTCCGTGTGTGGGTTGGAGATCTCTCAGGACAAGACGTCATTCTCGGCATGGATTTTATGGTTCCTGCGGGGGTGAGGTTGGACCTGGCTGACGG
AACGCTCTGTCTGCCGGACGAAGTTCGCATCCAGATGACCGACCGTAAGCCACTGTATAGCAGCAAGGCTGACGCGGTCTACGCAACGGGATTCCATGAA
GTCGGTCCTGGCCAATGGACAGAGATCTCACTCAAGTCCCACAACAAGCGGTTTGAACTGTAGGGGGAAAATGGGTGATCACGGTGGTGAATGGTGGATT
CGGTAACAAGTCATACCTCCGGATCACCAACATCAGCACGAGCCGCCTGGTACTGGATCGTTTGGTGTGTTTGGCAATCTGGTTACCCGTTGGGCAGATC
CCGCGTCGACCTGGATTCGCTAGGAAGGATTCAAACCGCTATCGGGAGTGGCAAACACTTGCGTTCGAAGCAGCTGTGGACACTGGAGATGCAAACGAAG
CGGAAGTTGAAGAGTCTGGACCGCTGGTCGAGCGTCCTAGCTACCGGACTCCGACTGCGATTTTAGCACGGCCTCCACAAGTGAAGACCGTTGAAGCAGC
AGCAACGTCAGAAGAATGCACGCGACTCACACTGGACGACACACATCCTCAAATGCAGCTGATGAAAAGTTCGACTGATCCGACTAGGGTGACCAAAACC
GAGGAGGACGTGATCTCTACCGACCCCGGTCAGGTGATCTCTGGTATGGACAGCGATGACTCCAGTCTACCGCGTACGGAAACTCACGCAGGCGAGGAGA
GCGGCCTATCCTTTACGAACAGTGGCGAAACACCGGTAGGCTTGGCGTCGACTCCGGCAAATGTGGCTGAGGCCGAGCTCCGCAAGGAGTTCCCAGAATA
TACCCCTGACCTCATGCCACAATCCAAAATACACGCCGCGACCACCGAGGAAATGGTTCATCGCACGTTGTCGGTCATCGTTGAAAGCGACTGGAGCGAC
AGCTGTGGCTGTGCGTCCGATAGCGCTGAGTCTACTGGTAGCTGGGGTAGTTTTGACTGGCAGACCGACGACGAGAAAGAAGAGGAGCCGGTGAGCGGAA
TGCTTCCAGTGACCCAGGTCGAACTAAGCCAAGGCGGAGATGCAACCGACATGGATGAAGCGAAGTATGTTCATGAAGGGGTCGATCTCACTGCGGAAGA
CATCGAAAAGGAGATGGCGGTGTTACCAGAGATCTCCCTGACGGCAGAAGTTAAAAGGGAAGATCTCAAGGTCGAGGATCCAACTGAGAACACAGCAGAG
GAGATTGATCGTCTGCGTGATATCATTTGGGAGCGGCGTCACCTTCTCATCGGCAAAGGGAATGCTTTACCCCCTGCGGCGACGGGGGCGATCTGTGACA
TCGACGTTGGTGGTGCACGACCGGTGACTCAGCGTTGTCGCCGGATCCCGCCTCAGTTTCGTGAAAAGGTGTTCCAACTCGTCAAGGGGCTACTGGGGGC
GAAGACGATTCGGATCTCCACTTCTCCTTGGGCGTCTCCGATCGTTATCGTCGTCAAGAAGAACGACGTGGACGTCCGACTCTGTATCGACTACCGTCTG
GTCAATGCTCTGACACGACTGATGATCTACCCCATGCCGTTGATTGACGACCTCCTCGAAGATCTCGACAGTTTGCTGTGGTTCTGTTCTCTCGACATGG
CGAGTGGGTTCTGGGTGGTGAGTATGACCGATCGAGCCCGAGAGATCTCCGCGTTCATTACGCCGTTCGGCCTGTTCGAGTGGCTGCGAATGCCGTTTGG
TCTGAAGAATGCCCCCCAAATCTATCTGCGGCTGATCGACAATGCGTTATATGGCGTGCTGCGGATCTCGCCGGGTCAAGATCGCGCGGATCTCGTCAAC
ATTTTCGAGGAAGGTGTTCCTGAAGATCGATCGCTGCCGTCGGTGCTGGGGCGTCGCTCTTACATCGACGACATCTTAGTTGGAGCAAGCTCGTGGAACG
AACTGTGTGAGAAGGTCAAGAATCTCCTAGAGCTTTGTGACCGCTGGAATCTGTCTATTAGCGCGGAGAAGAGCAGTTGGGGTATGAGCAAAGTCGACTA
TCTGGGGCATCAGATCTCCGGTGAAGGCCTGTTCACCAAGCCGAAAGATTTGGCAAGTCTGGAGGCGTTGAAGTTTCCCAAAACGCTTAAGGCTCTCCAG
TCATTCCTCGGCAGTCTCAACTACTACAATCGCTTCATCGAAGATTTCGCAGTATATGCCACAGTGTTGTATGAGTTCGGAGATTCCGATTTCATCAAGG
GTCGAGCGGAAATCACGAGGCGACTGTGAGATGGGGCCACACGCTACGAGCCTTCGATACCCTGAAGTTCAAGATGATCAACGCACCCATGCTCTACCAT
TTTGCCCCGGAGTTGGATCCTGTTGTGATTGTGTACGCAAGCAAGTGGGCGATCTCTGCCTCTCTCGTTCAGTGTCGTGATGGAGTGTACGTACCCGTCA
AATTTACGAGTAGGACACTGCGGTCTCACGAGATCGGGTACGACATTGTGGAGAACTAAGTACTGGCTCTGCTAAGAATCCTCGATAGCTGCTTCACCAT
GCTGA