Description :
From Genome Similarity Track
Location :
Scaffold_1:510400- 514268
Sequence
3868 bases(100 bases per row)
ACAAGAGATTCTGATCCTGAAGTCTTCCCTCTTGAAGCTTGACGCGGCCCGCCATGCAGATCAGGACAAGCATCGACGGCAAATGACATCGCTCAAGAAA
GAGTTGACCTCGGCAATCGCGTCCTCCAAGAATGCCGATAATCAAGCGAAGTACCAGATGGCCGATGTGAAGTTCGAATTTGCTGCCCGCCAGTCCGCGA
TCGCGTAGGATTGACCCGTGCGAAGAAAGATCTGTACATTCTTCAGGTCGAGCGCGATCGCCTGACGGACCAAGTTTCCGATCTCGCGGTTGAGCGTGAT
TGGCTCGCGCTGGACCTCGCCGGTCGGGATGCGGATCGTGATCGACTAGAAAGGGAAGTGACCGAGCTGAAGAAGGAACGCGATCAGGCACTCCACTTGA
AAGATTCGCTTTTCACTCGCCTGGCCGAAGTAGTCGCCAGAGTTTTTTTGAGTGATCCCCTTCTGCCCGCCGAAATGCTCTAGATAGCGTTCCTGCCTAG
ACAGAAACGATCACCCCCTGTTTCCTACAGTTCCGATGCGCCGGCGTCCCAGAAGATGCCCCCACCTCTACAGAAACGATCGGCTCCTGTCTCTACAACG
TCTGATGCACCGGCGTCGAAACGCGTCTGTCGTACCCGATCTTCACCGACTCGATCGGCTTCGCCTGATTCCTGTGGTTGTAAACCCCTTCACCGGAGCA
ATCGGAGGGCAGCGATCAAGTTGATACTTCTTCTGGGGATACAGATGATTCTCTGCTTGCGGTGTCATCGTCGTCCCGTTCTACCGCCCGTCGTGGAACT
GCGGCATCTTCCAAGAGATCATCGCCAGCTCCGTTTTCTTCGCCGATCTAAATTGACTCTCCTGGTCTGGCGAGTCCACCTCTCGAAAATCCCCCAAGAA
TATATATGGTGGATTTATTTGGGGAACCATCAAGTGATTTCGACGGAACCCTCAGTCTTTTTGGTGGACCACGAAGTCCGTGTAATTCGATGCTGACCTC
CAAGGAAGTTTCGGCGCTTCCAGACACCACCATAACCCGTGATCGTTGGATGCCGGGGTATCGTGATCGGGTTCCGCGATTGGCGATAGATGTGTTCCCC
TGGTCCGCTCGAAGAGTCAGCTTGAGCAGCGTGTCGAATCTGAATATAGACCTGTTCTATCACCACTTCTCGAAGCCTAAAGGATACATATTCCCTGTCC
AGCAGGGTAAGCTTCGTACCCCTCCGAAATCCTCTTGGTCATCCCAGCTGATCACGTCCACCAAGATTAACCAGTTTTACTATCAGCAACCGTGGGACGT
GTACAATCGGATCGTACGCCCGATCTTGGTCAAGTCCTCCGAGTAGTTTGAAGAACTGTTTTTTACGTGTATCATGGTTTCGTGAATTGCCATCGCCAAA
CTCTGTGGGATCGACACATTTCTTGTGGATTTTCCCTGTGCAGGGTAAAACGGATCCTGAGTTCCCGATATCTAACTTGTTGCAAGCCCGAAGGGTGAAG
CCATAAGTGACTGTGCACAAGGTGAATGATGAGATTTTAAATCTTACTTATCTCAATGCGCGTTTCTGTCTGTAAATAACGCCAGGAGTACCATGAACAT
CGTACTAAGTGCGACTCGGTCTCTCACCTCCTGTGCATGTCAATAACACTCGGTTTACCTATCACGTCGCACTAAGTAGAATCGCCTATTGTGTCCGTAA
GTAACGCTTGGTGTACTTTACACGTCGTACTTAGTGCGATGTAGTCTGTCGCATTTTTTGCATGTGTCTGCAAATAAACGATAGGTGTACCTTGTACCTT
ACACGTCGTACTATGTGCGATGTTGCCTTTATCCCATATTCATTGTTAATAGGCATTATGCGAGCCCGAAGGGTGAAGCTATTATTGAATGAGCGCAAGG
TGCGTGATATGCAGAACTTGAATCATTTCTATGGACGGAATTACTTATATCTAAGGGCGAGCTCCAGAGCTTGCTCCCCTATCTTATAGGAGGAAGTCGT
CTCGTTACGAAATAGCATTACAGAAACGTAAAAATTACGATCATCTGTGGCACGTAGGGAAAGAAAGCGAAAGGTGACAGGATCGATCGTGCTCACTATA
TATATCGAGATCACTAAGCAAAACGCAATTAGGGTGTGGGAAGGTAATGGCGTTGCGATAACAAATACTTACATGAACTCTCGAATATGAGGGCGAACCA
TTAGGCAGCGCCTGACTTGTGGTGGTCAGTTGGTGGAGATACGTTTAGTAGAATTAAAAAAAAATTGAAACGTCTACGTCAGCTCGTCACGTCAACTGCA
AATTAACGTACTCTCCATCATTCTATCAGTCTAGTATCAATAATACTAGTAAATAGACATGCCAACTATAATGTAAGAGCATGCATATGCGCTTGGTCGA
CTTAGTTGCACATTAAGACAAGCTAACTGCAACACAAAGTGGCCACCTCGATGATATCAAGTCTGCGAATCTATCATATGCTTTACATACATCGACTCGT
TGCCTTGGAATAGAGAGAGTATCATCTTGACGCAAACTGTGAGACATGTATTCGAAAGCCGTGTGTATAGCGCGACTAGACCGCACTTTTAATATAAAGT
TAGTACAAAGAAAAAATCTTACTTGGCTGCTGTTTGACAACATATGACTAGCAACTAGACCCAGCGTATGAATACGAACGTTGCAGAGGACAAGTTCAGT
AGCTGCGACTGCAACGTATCTTAAATGCACATCTCACGTCTGTAACTTTATACCATTGCACCGTCATGTGTTTTTGGAAATGATCTTACTGCTCATATTT
TTGAAAGGGTTGTTATCTCGATTCGAAACAATTGAATCGCTTATAATCACACCATAAGGTATATATACTACTTAGGCATCGTAAATATACGTAAGATTAC
CAAACTAAGAATCTTCAATATATGCGGGTCTGCGCCGATACATCACATTACTTTTGAAACACGACGATACCATTACTTAGCGTCACTGGCTTACGTGATC
GAATATGCACCCCATTGCAGGGCTGGCACCAAGTGATTTTTGTACAATCGGGTTTCACATGGTTTTTATTGAAAAATGACAGCCTGCGATCTTCCAGAAT
CAGATTTTATTAGTTTTATTTCCCTATAATCGTGTGACGCACGCACGATCCGGCCTGCCGCCGATCCCTGCAACTGCAAGGAAGCCAACATACATAATCT
TTCGTCAGTATCTTAGCAAGATTAGCACTCTATAGCCGTACTTACTACTATGTCGCAATCATCGTTTTCTTCAAGCCAGTTTGACGAGCATGTCTATAAT
TTCAACGACGACGTCCTCGACCTTCAGCAGCGAGGCGCGTAGGTCACCATGTTGGACTTCATAATGATCGTTGATGATAATATTGAAATGGAAGTCCGGG
CGCCAGAACGGAAATGCCGTCACTTTGCTAGCGCAGTCTGGAACTGGTTTACCGACGATGTGTCTCCACTAAATGCCAAGAGTGCGAATTTAAGCACTAA
AATACTCTGATTAATCACCATAAGAGAGCCAACGCGCCAAGGTGCACCTCCCGTAATTTATCGGAGTGGGACTGCCGAGGGGCAACCGATTACAGCTGGA
GGACGTCCTGTTCAAGTTTCTTGTAGACGACAAGCCCCACGATTCATTCGATGAAACACGAGCGCAGACCATTGGTATTCAGTGGACCGAGTTTTGTGAT
TGCGGCGACATTCACTCAAAGCTGAGGAGCTGCCTCAACCCAAAACGAGTCGACGAACTGAGGTTCATTGACCTTCTACGACTACATGCACGACGGTGAC
GATGATTCCGGCAGTCAATCTTCCCAGTAGGCGCCCGCTCATCGAGCCGAATAAAACCACGTTTTTTG