Description :
From Genome Similarity Track
Location :
contig_14:510143- 511867
Transcript NameFunction/comments
g3023.t1hypothetical protein

Sequence
1724 bases(100 bases per row)
ATTCTCTAGTCGATTGAGGTGGAGGTTCGTCGATTGTCCTGGCAAGTCTCTACATGAACTGAGTCCTCCAATTCGGCGCAGCTGGCCGCGCGGACGAGCT
CGTGCTGCTCCAGTCGCCCAGCCGTTCAAGGACGCGGGCTGCTAACCCAGATCCAGATAATGCTGGAGCTATCCGCGTCGACTAGAGCTCACCTAAAGCG
ACTAAGGTTAATTGAGATGGCGCCGGCACTGGTGGATAATTTCTCGCTGCAGCTGTGGTGCGAGTGACTATTATACAATCATACCCGATCCCGACGATGC
GATCCCGAAAGATTAACGCCAAGGAGGACGCTTCTTCTCAACGATAACACCTCTAGGCCGTCAGTTCTTGGAGAGACTGTGCCGCCCGCCCACGGTCTCG
TCAAGCGGGTGTCCTGCCTCATTTGCAAATCTGCAACCTCCTCCACACCACATTCCTTCGAGTTCCACTTCAAGATGGTCAAGGTCTTCGCTATTACCGC
CACCATCGCTACTTTCGCTGCTGCCACCGCGTCAGCCGCCTCTGTTCCTGACGGAACGTGGCCCACCAGCCAGGGCGATGTCTACTACACGGAGCCCTAC
ACGGTCGCGGCTGGAGAGACCTTCGACGGCGGTCTCAAGACGTACCAGCGCTCGGACATCACGTGCGAGGGCCAGGAGGAGAGCGGTTCGTCCACGGCCG
TGTTCCTCGTGGAGGCCGGCGGGACCCTCAAGAATGCCATCATTGGTACCGACCAAATGGAGGGCGTGCACTGCGACAAGCACGACTGCATCATTGAGAA
TGTGGTGGGACGACGTGTGCGAGGACGCCTGAGTGTCAAGGGCGGCTCGGCGTCTAGCGTGACGAAGGTCATCGGCGGCGGCGCTCGTAACGCCGACGAC
AAGGTGATCCAGCACAACGGATACGGCACCGTCAAGATCGACGGCTTCTACGCCGAGACCTTCGGCAAGCTGTACCGTTCGTGTGGTACTTGCGGCGACA
AGCAGCGGTTTGTGAGCGTGTCGAACGTGTACGCTGTGAACCCGAGCGTGAGCATTGTGACGGTGAACGACAACTATGGGGACGAGGCCACACTCAGCAA
CATCTACATCTCGTCGGATGACGACGGATACACGGTCTGTGCGTGGTCGCAGGGCAGTGAGGACGGTGAGCCGACGGAGCTGGGCGATGGCATCAAGGAT
CCGCTGTGCCAGTACTCGGAGAGCGACATCCACGTGAACGGGGATGTGTCGACGGCCACGAGTACCTCGTCGAACTCGACTACTTCGACCTCAACCTCGA
CCTCGACCTCGACACCGCCGCAAGCAGTGGTTCGTCCACGTCGAGCACCACGACTAGCGCTCCCGTGTCCAGCAGCAGCAACACGCAAGAGAGCTCGGAG
TCCAGTGAGACGAGCCCGTCCACCAGCTCCCAATCGAAGAAGGATAGCGATGACGACGATGAGGAAGACCAGACGAGCTCGGACAAGGACGATGATGATG
ACAAGGACGACAGCGACGACTAAGTTGTTCGCTAGGATACTGAGGGCGGCGGCAGTAGTTGAGTCGCTACGTGTATATGTGCATGAGTTCGAGTCGCGTT
ATTCGAAGGGAAGAAAAGCAAGGAACAGCGCGTTCCATTTGATGGTGTAGGTGGATACTAGAAATACAACCGCAGTTTGTTTAAGCAAACCCACTGACTT
CCGTTTCGCTCCACCTCGAAGTTT