Description :
From Genome Similarity Track
Location :
Scaffold_559:5101- 8050
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_559-snap-gene-0.6Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_559-snap-gene-0.137 transmebrane protein Gpr8

Sequence
2949 bases(100 bases per row)
GACCGAGCATGCCGACTCGCTATTCTCGTTCGTGATCCCGTTGGTGCAGAGCAAGGCGTTCCACCTAGTGCAGCTCAGCGAGCTCATCGAGGCCGACAAC
ATCTTAACAAGCCACATGGCGATCCGATCTGCATTTCGCCAAGACCAGGACCCGTCCCTGCCTGCAACAGCCACCGGCTCGGTCATCGCCAACAACACCA
AGGATAACAACCAACCTAGAGTGTTGCTGCAAGGATTCCAGCTTTGGTCAGCTCTCGCCACGCACTGGGATGATCATGCGTTTGCAGCATTGTGGCTCCG
AGATCTGCAGAGCCAGCCGCACCAAAACGAGTTGGCCATCACGCCACCTTCGCGCTTCACCATGGTCTTCCCAGCGTTTGCGCTGGAAGAGCTAGCAATG
GACCACGTGGTGACAATTGTGCGCAGCGTACTGAGCTTTCCTTCGTCCATGAAGTCCAAGCTCCAGGAGAGTTGTCGCAACCAGAGTGGCAAGTTCTGGG
TTGGTCTAAAGACGTTCTCAGGAAATGTGGTGGTGCTGCGCTTCGCCCTGGCTGAGAGTACGATCCTGATTGACGGCGAGATGCTGCGGCCGCTCGAAGT
CCTGCTCCAGTGCTCCAGCGCCGACGATCTCTCTACGGTGAGTTATTTGTCATCTGTGGTGGGCAACAACGTTGGGATTAACTCATTTCTCACAAACTAC
AATTTCGAATGCTGTCGTAGATGCGAGCGCTGCTGCTGGAGGGTGTGCCGCGGAGCCCGGGCCACGAGGATATGTCCATGCCGCTCGACGAAGTTTTCTC
TGCGCTCTCTCTTGAGGCGAGCGAGTTCCGCGATTCGCTGGCTGAGGCCGAGACGCTCGCACTGGTACGCAAGGAATCTGTCCTGTGTTCACCTAGCATT
ATTTGCTCACATATGTCTTGATGCCAATCTAACCAGGTGGTCGCTGAGAAGATTGCGACGAACCTACAGAGCTCCGAGAGCTCACTGTGTGCGGACGAAG
TGGTGCGCATGTTGGCGGATGTCGCGCGCGTGGAGACCCAGACGCTGGAGCTCTACTGGAAGTCTCGACAAGTGCTCAACAAGTTTGTCATTTGAGTGCG
AGAAGTACTTGCGCTTTGCTGATATTGCTGTTGGGTCTTAGCGAACGGAAACTTCAGCTGTCTGTCTGATCATTGAAAGCCGTAACGGAGAAGGAGCGGA
ATCGAAATGAAGAACCCTCTCGTTGCCGAGAGCCAAGCGACACGGTTCAAGACATGCAAGCGGCGCTGGCAGCAGCCTCCATATAAAGAAGAAAACGAAA
ATGAACGGGTGAGCTCCAGCAGCTCTAGAGCTCCTCGGTGGGCAGGTGTTGCTCACGCAGTGACGCCTTCTCCGACGGTGACGATACCGAGTACAGACGC
TGCAGTGAAGACAGAGAAACAACACCAGCCCGTTCGTGAACAAAGACAGCAGCCGTTGGGCTACAAAGGAAGCGTGGATGCGCACCTCAAAGTAGCGTGG
CGCGCGCGACGGCCAGAGCAAGTAGACGAGCGCAGCGTAGATGCAGAGCTCCACGCTCGTCGTGATCGCCGCAACGGTCTTCTCGCGCACCCACGGTGAC
AAAAATGACGCGATGAGGACGATCACCGGCAGCGCGGTAATGTACACGGAGAAGAGCCCGGCAATCTACAGACATACAGTCAACGAAGTCAAAACGTGGG
TAAGCCATTGACCACCGGTATTGCTACTGTAACAACCCGTACCTGGAGGAAAAAGCGTCGCTTGCCTGCTGCCTCTTCGTACGCGCGTGTGTCCAGAATG
GTGTTGACGAACCAGACAAGCACGCCCAGCAGCATGACGCAGATGCCGATCCCGGGCCACGAGTCGTAGATGTAAAGCGTCGACGCCGGGTCGAGCCAGA
CGAGGTACCACATCGCCATGGACAGGTAGAGCACGAGGATGGAGATGATGAGACACGAGAGCTTCTCCTGGCCCTCCAGGGCCACGCTGTTGATCGTCCA
GCCCTTCGCGACGAGCATCGCGAGCAAGATCGTGCCGACGCGCACAAAGACCTGCATGATTTTGGCCGAGTACTCGAAGAGCGGCACGCCCACGCCCGTG
AACTGGTACACATAGAAGTGGAAGAAAAGTAGCGCATTCGAGACGCTGAAGAAGAACAGGACCATCATGAGCAGCTTCATGATCGGGTGGAACGACTCGG
ACTGCCTCAGGCCGCGCGCCGCGACCGTCTGCACCAGCGCCGCTGCCGCTGAGAGCACCGCCATGAGGCCGTAGATGACCGTCATCCCCTGCTGCTGAAC
GGGCAGCTCGCTGCCGTTCGCCTGTGTCATGTGGATGCTGTACCACGACGAGAAGTAGTACTTTCTGAAGTTCGCCTCGGTGATCTGCGTGAACGACGGC
TCGTATGAGTCCCCGCCCGGCACGCATCGCGCGAGCGCGACATACCTGCAGCACAGTACATATCATGCGTTAGCATTGTTTTCAAACCAAACAAAAAATG
ATTGGCTGTGAGTGCATACCAGAAGCGTGGACGCAGGTGCTCGTGGATGTCAAAGCTGAACGTGAACGGGAGCGACAGGTCCGTGGTCGCCGAGACGTTG
TACAGGCCCTTGGTGTGCTCTGGCGAGATCTTGCACAGGCAGTCGCAGTCTTCGTCGGTCATGATGTACTCCCAGAAGAGCTCCTCGTCGTCGTAGATGG
CGAGCTGCAGGTCCTGCACGTCGGTCTGGATCTCGCCCGTGATACGCTGCACAAGTTCAAGATACAAGCAACGGGTTAGTATCCACAGCTACGTGACCAC
ACCGCCATCACCAACAGCAGCAGCACGCACCCCAGCGAGCTCTTCGAGTGTCGGCTTCCACGTGAAGCAGAACTTGCCAATGAACTCGAACTGGCGGCCG
ACCGCGAAGCCTGAGTAGACGCTCGCGCGCACGCACGACGGCGCCACCA