Description :
From Genome Similarity Track
Location :
Scaffold_1455:5101- 6721
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1455-snap-gene-0.6Radial spoke head 10 family protein

Sequence
1620 bases(100 bases per row)
CCGCTGGACCCGCGCATCCTGAGCAACGTCATGAGCAGCTACGAGGGCGAGACGCTGAAGGTGCCGCACTGCGACGTGCCCGTGTACCACGGTCGCGGGC
GCTTGGCCTTCCGCACGGGCTTTGTCTACTGCGGGGATCTGTACTTGGGCCGCATGCACGGCCGCGGCCGCATCGAGTGGACAGCCAGCGGCGTCGTGTT
CGAGGGTGACTTTGTGGCCAACGAGATGCGCGGCTGGGGCGAGTACACGTGGCCCAATGGTAGCTCGTACTCGGGTGACATCGTCGCGGGCAAGCGCCAC
GGTCACGGCGTGTTCATCACGGGCCGTATCGGTGTCCCCAGTCTTCACTGTCCACCTGGCGAGGACGCTGCTGGGGACACTCTCTTGACGGCCACCGAGT
CCATGACGATGCTGCCAGTTCAGCCTGTGGACTCACTGCTGCTCTTCTCCTTCCAGCACCAGAGCGACCGCAATTGTAATGATGATGGAGACCAAGCCAA
CATCTCGGCGCAGAGCAACGCGCGCTACGAGGGCCAGTGGGTCGACGGCCTCCCGCACGGCCACGGCGTGCTCGTGTACGACGACAACAGCGACGTGCGC
TACGAGGGCTCTTTCGTGCGTGGCAAGCGCGAGGGGAAGGGTGCCATGCGCTACGCCAGCGAGAATATGTACACTGGCGCGTGGGAAGGTGACGTGAAGC
GCGGCTTTGGCGTCATGCGGTGGATGGGCCCAGCGGATGAGCTGCACGAGGTGTACGAGGGCCAGTGGCTGGACGACTGCCAGCACGGCTTCGGACGCCA
CGTGTGGCTGCACACGCGCCAGAAGGAGAAGAACTACTACGAGGGCGAGTTCGCGCGCGGCCTGCGCCACGGGCTCGGCGTCTTCTTCTACGCCAACGGC
GCGCGCTACGAGGGCGAGTGGCGTGAGAACGTCAAGGACGGCCGCGGCACGTTCTTCTACGAGGACGGACGCGTGTTCCGGGGAGCGTTCCGAGACGACC
GCAGCGTGGAGACTGACGCGGCGCTGGCCACGGAGGCAATTGCGGCTGCGCAGAGTGGCTCGGGTGGGGCTGCGTCGTCCACTTCCGCCCGCCTCGTGCT
CTACATTGACGCACTGCTGCCTGCGGACGGTCGCGACAAGGCGCGAAAGGCGGTCGAACACGCAGCACTGCGGCTCAACACGGAGCTGCGCGCGCTCTAC
CGTCACTACATGAAGGACAATCTGTCGACTGGTACTGGTAATAGTGTCCCGTCGGACGAAAGCGTCCTCCTGATGGAGACGTTCGAGAGTCGGAAGCTGC
TCGCAGAGTGTGGTGTCCACATCAACAGTGGACACTTGGAGCAGATCGTGGAGGACATTCGATCTGCGCAGCGTCAGAGCGTCAAGACATGTGCTGTCGT
GAGGCCACCAGTGTCCACAGAAGAAGAAGACAAGCCCACCAACAGTTGTCCATCTGAAGAGGACACTATCACCAACAGACCAGAGGACGCTCTCACGTTC
CTCGAGCAGCTCCAGCTCAGGAACACGCTGCCGAAAGACGGCTCCAGCTGTGCCAACATCGTCCCCCACGACCAGCTGCTGCTCTACCGCGAGTTCGTCG
AGCTGCTCGTCCGCATCGCG