Description :
From Genome Similarity Track
Location :
Scaffold_1:510097- 514595
Sequence
4498 bases(100 bases per row)
GCTGTATCGGTCAGCAAAGACCACAACTCCAGTCCTCCGCTTGTTGCCTGGCGAAAGACCGTATACAAAGTCCATAGAAATGGACTGCCATCATTCCGAC
GGTGTCGGTAGTGACTGTAATGGAGCCTGCAAATACGCAGCAGGCTTCACGCGTTGGCACACTTTGCAAGCACGTACGTACTTGCGCACCCACTTGTACT
GGTGATCCCAGTACAAGTCTCTCGTGAGAAGCGCGTACGGCTTCTCACGGCTCGGGTGCCCTGCCTTAGGGGCATCGAAATACTCGTACGTGATCCGCAT
CGTCGTCCACTGCGCTGTAAAGCAACAGTCCTTCGTGCAAACGATATCGATGTGCACGAGCTCGCAGATGTGGTGACAATTTCCGACGTGACACGTCAGA
AGGTGCTAAGACATAGTCTAGCAGTTGTTTCGCGTCTGCGTCACTCGCATACGCAATCTTCACGTCGTCGATCAATGTCGACGACGGAACCCGTACTCGT
TCGACGCCAATTCTATTGACGTCGGCTGCCTTAACGGCATTATCCACATCCAACCTTCCAGGTTTGTACTCAACCTGGAAGACGTACTCCGCAAAGAACG
ACAACCATCTTGCCATTCGTTGCGAGGTGTGCGGAGTCTTCACTGCAGTTCGCAGTCAAGCGTGGTTGGCGTAAAACACGAACGGTCTACTCCCAAGTAA
ATACACTCGAAACTTCGCGAGTGCATACCTCATGGAAAGGAGCTCCTTGTCATGTACAGGATAGTTACGCTCGGCTGGCTTCAGCTGACGCGACTGGTAG
TAGATCACACGATCACGACATTAGTGCTCGTGCTGCATCAACGCGCATCCGATCGCAAATTTAGACGCGTCACACACGATATGTAATGGGCGATTTTGGT
CAGCCACTGTCAAGACCGGCGCCTCAAGCAAGCCCTGGTTGGCTGTATCGAAGGCATGCTCACACTCAGCAGTCCAAATCCACTCAGCCTCCTTTTTCAG
AAGCTCTGACAGCGGGCAAATCTTGCCCGCGTAATTCTCAATGTACTTGCACAAGTACGCTGCAAGTCCAAGGAACTGCCTCAGCTCCTTCACGTTGGAT
GGCGTAGGCCATTCATTGATCGCTCAGACCTTTTTCTGGGTCAGGGCGTACGCCGTTCTTCCCGACGGGTCACCCAAGGACGAGCATCTCGCTCGCCCCG
AAGATACATTTCTTCTGGGTTGCAGAGAGCTAATCTTTACGCATAAGCCCTACCAGTTGATGGAGGTGCTCTTTGTGCACCTCAACGTCAGTCTTCCCGG
TCACAGCCCGGCTGTCAACGAGCACGTCATTGAAGTAGCTCGGTGCGAATTCACGCACTGAGCTCAATAGATGCGTTACACATCTATTGAAGGTTGCAGG
GACGTTCTTTCGTCTCTGCAGCATTACTAGCCACTCCCAAAGCATACCGCTTGGAGTGCTCACCGCCGTGAGAAGGATGCCCATCTCACGCATCAGGATT
TGATAGAACCCGTCGCGCAGATCAAGAACACTATCGATGATGCTCCTGTCCATCGAATCGATAATAACATCTTTTCGTGGTATCGGCGTCTGCGCCGATA
TCGTCGCACCGTTCGGCTTGTTATAAGCATGAACGATGCGCCATCCGCTCTGTGGTTCTTGACACAGAACGTTGGTGCGCTGTGCGAGGACTTTGCTTCC
CGCATTACTACGACTTTCAAAGAAGTCGTCAATTGCCTTTACTTGATCACGCGGCAGTGGTCACTGCCGCGTCGTCCAGTACTTCGTGCCCGGCACGGGG
TCGATCGCGTGCTGTATGCCCTTACATTGCGGAACTATCGCAGGAATCTCTTCCGGGAGCACATCCTTGTGCTCTAGCAGAACATCGTAGAAGGGACTCG
ACTTCAATGAATCCTAGCTCTGCTCGTCGAAGCGCTGCTTCTTTGTCTTCGCGCTGAGAGTGTTCTTACTCTCAGCGGTATTCGCAGCGTGGGGTTGCCT
CAACTCCTCCTCTTCACTTTCCACCCTTTCGCTGTCCGAAAGGATGCATATCTGTTCGATGCGCCCATCGTACAGGTCATTCGCGAAGCGCATCCAGACC
ATGACTGGAAGCGGCATCAGCTCCGATGCATTCGTCGGAGGATTCTCCGGTTGCATTGACCGGTACTGGTACCAGTACTAGTCCGCGTCAAGACGTTCAA
CGTCTCGACGCACGACGTCATCTCTGATGTCTGCCCGGCAGAAATCGCTCATATTGCATCGGTCCCGGACCGAGACTTGCACAGCTTTCGTCGCTTGCGC
CGTCTTTTGTTCTTGTGATGCCCGGCTTCACATGTTTCTCGTCCAGGCCCGCCCTTGGACGGATTTCCGTTGTAGCCGAAAGAATCGGCGGAATCTTTCC
GCGGACGCGAATGATCAAGCCCGGCTTGAATGCATTCCGATTCTTGGTGCAGCCCGGTTGAACGCGACCACGCAAGCGTTTTAAGTGTGGACGTTTACAA
CCGTTAACACTGCTTACCGTATCATCCGCCCCCGGAGCAGAAGCCCTGTCATCACCTCGCCTATCCGCGGCGTTCCATCTCGATGTTGATATCGTGTTTG
TGTCGACTCCCGGAGTCGACACGTCCTTATTACCTCGACGCCTTTCGGCGGAGCTCTTCGTGATTTTTGATCCAATCACGACCGTATCAACTCCCAGAGC
TGACACGCCGACATCACAGCTACCGTCTGTAGCTGGCGTCCCTTGCATATCTGATGCGTCAGTCCCCGGGACCGACGCACCACCGGCACAGCTATTGCCT
GTGACAAGTACAAGTACATCAACTCTCCGAGCTGATACGATCATTGAAGTATGAACGTGTCTCAAATCTGATTTCCGATTTAAGCCAGACCCAACGACTG
CCTCAGTCGCTGCGACTTGTGCATGGGCACCAACGGTGGGATTGGATGCATCTCGTGGTGCATGCGCCGACAGGGCCATCGCTCTCTGTCGCGTTGCGTC
CGTAGTGTACAAGTGTACACTTCTCCCAGATGATCACTGGATCATGCCGTTTAAGCCGCCCAATACCAGGTTAAGCTTATCGTCCAGCTCCAGGACGATG
AGATCTTCCACCAACACCCGGTGTTTGTACGAGAAGCGCGCGCGTACTACGCGCTTCTCCGTCCTTACGGTGGCACCTGTTGCCAACCGTACCTCAAATA
CACTTCGAGGTGTTCTAACTTCCTCGACGTCTAACTAACTTCGGGAGACTTTCCAATCGAACAAAGCTGTTCGGCGCACCCGAGTAAGCCAAAGCACGAA
GAGACCCTGCTCTCATCGACGTCACTTTCAGGATGACAGAATTTGGCTTGTCATCTTGCTTCTTGCAGCGAGAATTCCTCTTGCTGGGGACTGCAGTCCT
CAGTGTCGCGTGTCCGTTGTAGCCACGCGCGACTGAAATACCAATAGGGCGTCCCGCGTTTACTGGTTCTGCATGTTTTTGATAGCATGCCGGCATCGCC
ACGTTGGACCCTGGCCGAGTGCACACTCACGCGCAAAGTGTCCAATGTACCCATATCGGTAACACCGCACGTATCCCCCAATACGCTATTGGCGCCCAAC
AGCAGAAGCTCTCGAGAGGTCCAAAGGCTCTAAACCTCCCGCTCTCATCAGCGAACGTGCTGAGAATGGCATGTTCGCATGCATCTTAGCCTGCTTCAGG
ATAAACCCCTCTTGCATCGCAAGAGTAATCGCAGCTCCGAGAGTACTTGGGTACTCTCGGAAGAGATAGGTCTTAACCGACCCATCCTTTAAGCCCTTCA
TGAACGTGACGATTTTGGTCGCCTCGTCGATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGCGCACGTTGGTCGTAAGCATGAACGTCAGGCTTACC
TTGCTGCAGGTCGAGAAACTCTGCTCTCGACCGGAACTCATTCTGAGGGGGCTAAAACGCTTGTCTGAGCTCCTCCTTAAATATCGCGTACGTGCTAAAG
CACGTATGGTTTGTGAGCCGGGGGCCATACGCCCAGCTCCTCGCTCGTCCGCCAAGGCATGGCATGGCGAACGCAACCTTCGATGTTTGTCGGTGATATG
ACAAGCCGCTATGGCAGTGTCGAGCTCGACAAGCCATCAGAGAAGAGGCTCGCCCTCTTTTCCCACGTAATTGCTCACGTGCAGCTTCAACGACTACACG
CGCGGTGTCGTGCTGGACCACACTTTAATAGTAGCAGCAGCATCGCGCTGCTCGCTCACGATAAATCCCAAAGCAACGCCGTGTTGCTCTGTCGGCGACA
GCATACGTAGTATTGTCGCTACGGCTGCCTCTCCAATGACTGTTGACAGTCTTTGGAGAGCTTTCCACTCTGGATCCGCGAGACGGGGACAGCCTGCATG
CACAATGTGCGTGGCAAAAGCATTCGGGCTACGCATGGATGGATTACAGTCCATGGGCTGGTATTCTGCCCCGTGTTCATATTCCATACGAACGCGTT