Description :
From Genome Similarity Track
Location :
scaffold_86:51005- 57749
Transcript NameFunction/comments
g6798.t1 hypothetical protein PHYSODRAFT_297590
g6799.t1 hypothetical protein PHYSODRAFT_312327
g6800.t1 hypothetical protein PHYSODRAFT_484119
g6801.t1hypothetical protein
g6802.t1 conserved hypothetical protein

Sequence
6744 bases(100 bases per row)
TGGATTGTCGTGCTCTTTTTTCATGTTTTCAATACGGGTTACTCGGTATCTCTCGCCTACGTTTATCACTACATGTCTTCCCCCGCAATGGACTACTACG
TCCAGCTGTTGCGAATGATGCCACAAGAAAACTATAATGGAATTATCGCTCTCTATGCCTGCATTGGGGCTGTGAACTTTTACAGTGCGCTGAAGATGTC
TCTCTACTCGCTGTACTATCGACGACTGGTCTTTCGTAAGATGGCGGATACGAATATCGACACAGAAGACGAGGAAGAGAATGAGGAAAAAGAAGAAAAT
GTAGGTGTTTCAACGAGATTCCGAGCATTAACACGTTTCGCGTCTGGATTTGCACGAGCCACCAGCGCTCGCGGCGAGTGGTTCGATACAGTTCTGCTCA
TGCGAGAGGTAGCCGAAATTTCATCTCAGACTGTGCAGGCTTACTCATCGAGCTATCTCATCAGCAGTGTCTGGATGAACCAGGTATTTGCAGGGTTGAT
CTTCTTGAACGCAATTGCTAACACGCTCGTGCACTACAACCTGGAGGGAAAAGTTGGTCTGAGGCGGTTGTACAGCACTGCGATTGATCTGTCACTAGAC
TTCGCGTGGGGTTTTATAATTCCAGGGAAGATCATATTCGTCTACATCTCGATGTTCATGGCAAACAACGGTTCGTTTCCAAACGAGTTCAATTACTCCG
ACACGCTCCAAATCAAAGCAATCTTGGAATGCAACCAGTTCTTCATGGTTACGTGGTTGGATGCGGTGACCACGACGTTGCCATACCTGAACATGCTTTC
GGGTCTGCGAAGCGTAAAATTCTTAATCCAGCACGACATGGAGGTGGTTCGTTTTATTTCATCAACGAAAGTCCAGCCTATAGGGCCGACGGCACAACTT
GCAAAGCTGCAAGGGGCTGTCGTCGCCCCAGATCCAGCGCAAAAGGCTCCAGGATTGGCAAAAGTCGCGGACTCCGAAGAACACCAGGTCGAAATAAAGC
GCAGCGTCTGTGGAAGGCTAACAACAGGCGTCGTAGCACTAATGCCTCTCTGTGGACTGTTTGTCCTGCTCACATCTATCACTTCATCGGGGGTATTCTT
TAGCGGCGAACGCACATGTGCCGTGGGTTGCAAATTGCACATGCACCCGTGGTTCTCTACGAAGTGTTCATGTTCAGTCATGGAGATGAACTGCTTCGAG
CGGGGTATCACTGGTCGCGAAGCCGAAACTCGTGACATTCTGCAGTCGCTCGACCCCAAAGTGTTGAACTCTCTCATCATCTCGCACTGCCCTGAGCTTG
TTATCACCGAGGACATTCGCCGGTTCAGCAATCTCATGGCTCTCGAGCTGTACAACTCGACGGTTGTAGAGTGGTTGAGTGCCGCGTCCTTGTCACTTCC
CTACATTCCGTCCCTCACGACAATATTTGTCGTGCGATCTCGATTCCTAGGCGGCCTCCCAGAGGGTTTAACGACCGATTTGTCGCCGAGTGTCGTGGAC
GTCGAGTTCGTAGCGTCGGATCTCGGTGGGCCATTACCAGACGACCTCGACGAGAAGTGGACGTCCGTTATAATGCTGTACTTGGAGCACTGTGGACTGC
AGGAGTTCCCACCTGCCATCACCAGGATGAAGCTGACGGATCTGTCCCTGGTGGACAACAACATCTCGGTAGTCCCGGACAGGATAAGCGAGAGAGCCAT
GTACGTTATGCTGGACCGCAACCCACTAAGTCACATCCCCGACAGCTACGCGTCTCTGCGAGAGCTCTTCTACTTGTCGTTCCAGTACACCAACATCGCG
TCACTTCCGCAATGGCTGCAAGATCTGCGAGCGGAAGGCGCCGGCATCAACTTCCGAGCGCTAGGCACGCCCTACTGTCACGACCTTCCACTCAACAGCT
CCGAGGCAGTCTTCGCCGCCTGCAACTGGGACGACTACAGCCACGGCATATTCCCGTTACCCACGAGGGACCAAGCGCGTGCCATCCGCGACTAACGTTC
ATTGAAAAACGAATCATTGACGCAATCGACCATCATTCTCGTTGACTTCTAAAGTCAAGAAAATCTTCCCTGAAGTCAAAAGTCCGCCGTCGGCTCAGTC
ACCTCCACTTTGTATTGCCAATGTCGCTGCTCCACGGCCGCAGCATCTTCCTGCGCGGCGTGCGGCGCCTCGAGGTGGTGCAGCGTGCGCGTATCTCGCC
TATCGCGTCCTCGCTGCGGCTGAGTCGCCGTCCGTTTGTGCTGCCTGCGCTGGGCAGCGGCGTGTTGAGCTTCTCGACGTCGGCGCTGGACGAGCATGAG
AAGACTAAGAAGGAGAAGAAGCAGCTGAACGCGCTGAGCGGCATGGGGCTGGACCGCCCGCCTGACACTGGCAAGGAGATCCTCAGCTTCCTGATGGGCC
ATTTATGGCCTAACGAGGACACCAAAGAGGCCAAGGAGATAAAGCAGAAGGTGCTTATCTCGGCGGGTCTCGTGGTGGCTTCCAAGGCGCTGACGATCCA
AGTGCCGTTCATCTTCAAGGATCTGGTGAACAGTATGGGAGAGGCCTCCAGCGTAATGGCAGGATCGCCTGAGATCGCGGTGCCCCTGGCCATGGTGCTC
GGATACGGCCTCGCTCGCTTCAGTGCCAGTGCGTCCTCGGAGCTGGCCAATGGCGTGTTCGCTACCGTGGCGCAGAAGACCATCCGCAAGGTTGCAGTAC
GCGTGTTCAAGCACTTGCATGCGATGGACCTCAAGTTCCACTTGGACCGACAGACGGGAGCGCTGTCGCGCATCATTGACCGCGGCTCGCGATCCATTGA
TTTTGTGCTGCGTGCGATGGCGTTCCGGGTGGTGCCGACGGTGCTGGAGATTGGACTGGTGAGCACCATCATGGCAACGAGTTTTGGGCTGCCGTATGCG
GGTGTCACGCTTGGTACTCTCGCTGCGTACACGACGTTCACGGTACTGGTCACGCAGTGGCGTGACGAAATTCGCCGTGAGATGAACCGACTTGAAAATG
AGGCTGGCGCGAAGGTGATCGACTCACTGATGAATTACGAGACTGTCAAGTATTTCAACAACGAAGATCACGAGACTGCGCGGTACGATGAGTCGCTGAA
GGGATACCAGAATGCGGCACTCAAGACGCAGACGTCTCTCGCAATGCTGAACGCCGGACAGAATGGTATCTTTAGTGTTGGACTCATTGCTATCATGTAC
ATGGCGTGCGAAGGCATCGCTGCCGGCACGCTCACCGTTGGCGACCTGGTGCTTGTGAATGGTTTGCTGTTCCAACTGTCCATCCCGCTCAACTTCATTG
GTAGCATCTACCGTGAAGTGCGCCAGTCGGTGACTGACATGGAGTCGATGTTCAAGCTTGGTGCTGTTTCGCCCGTTATCACGAACCCGGACGAAAATCT
GAGCCTACAGGGCAAGGGGCCCAAGTCGATTGAGTTCCGTGACGTGGACTTTGGATACCGCCCCGAACTTCCGATCCTGCGCAAGACGTCCTTCAAGGTA
GACGCTGGCAAGCGTGTTGCTATTGTCGGCACGAGTGGCTCTGGTAAGTCCACAGTGCTTCGGTTACTCTACCGCTTCTACGACCCACAGAACGGTACCA
TTCTTATCGATGGCAAGGACATTCGCCAGCTGAGCCTGGATGAGCTGCGCCAGGCCATCGCTATTGTCCCTCAGGACACTGTGCTGTTCAACGACACGAT
CTTCTACAACATCAACTACGGTCGTCTGGACGCCACGCCTGAGGAAGTGATGAACGCTGCCCGCGTTTCACAGATCCACCGCTCGATCGAGACGTTCTCG
GACGGATACAACACTCGCGTGGGTGAGCGCGGACTGAAGTTATCTGGCGGTGAGAAGCAGCGTGTGTCAATCGCGCGCGCGATGCTGAAGGACTCGCCGA
TCCTGCTGTTTGACGAGGCTACCAGTGCCCTTGACTCGGAGACCGAGTCGGAGATCGTGCGTGAGTTCGCTTCCATCGGTGCGAACCGCACGTCGCTGAT
CATTGCTCACCGTCTGTCGACCATCCAAGACGCGGACGAGATCATCGTGTTCAACAAGGGCCACGTGATCCAGCAGGGCTCGCATGAGGAGTTGCTGCGC
GACGTGGAGGGCAAGTACGCCGAGATGTGGGGTCGCCAGAACAACCACGTGCTTGGTCTGCTTGGCGCCGGCGACGACGACGACGACGACGAGGCCAATA
CCCTGTAAATTGAACTCGACCACTTCAACTACAACGTTTTCTGTGGTTCACACAACTATGTCATTCTTCTATTTAGTGACAGTCTAGAGCCAAAATAGAA
TCGCAGCATCGCACACACCAGCTCCCTCCGCGATGGACGCGCTGCTCGTGGGCGAGGGCCGCCTGAGCAGCAGCTCCAGTTCCTACAGTTCCAGCGACGA
CGAGCCCTTGAGTCTCAGCCTCAAGCGCCACGGCGTGATGGCGCCCCCTCCTCCGCCGGACTCGCCGCCGCCAGACATGATGCCGCCGCCGCCTCCGCCT
GGACCGCCTCCTCCCGTCGACACGAAGCGCAAGCCGTCGAGACCGCGGCGATCAAAGACCAACACTCCGACAGTCGAGAAACGGGCACGGAAGGTGACGC
CCAAAACGTTGGCCAGGAAGCCGAGAGTGCGACGTCAGGCGTCTCCCACGAAGCAGCAACAGGTTGAGACGCCCGTCGAGAGTGTGGAGGAGGAAGAGGA
GGAGGAGATGGACGAGGAAGACTTGGACGCGTACTCGGACCAGTCTGACGTGTTCGAAGACGACGTCGAGGCCATTTTGTTCGCGGAAGAGGAGGAGGAT
CGTAGCAAAGGCTACACGGACTGTCTGACAGAGACCCACTTGGACAGCGCAGAGTACCCGTACCCGGCGTACCTGGCCAAGCTGTCAGCACTGTTTACGG
AGCAAAGCGCTTTCGGGAAGAACCCCGAGGACTTTATTTATTGCAACAACCTGCTGGTGCGTTCCCGTGGATTGTAGTGATGGATCTGTATCGTAGTGAC
TGATGAGGGCGTTTCGTGTTTGCAGGTTAGTCCGAGTCAACTCAAACTTATGGATGAACGGACCGCTGCACTAGAACGTGGGAAACTGGAACAAGTGCGA
ACAGCAACAGCGTTGAAGGCGAAGGAAGATGAAAAGAGGAGAAAGCAGGAGAGGTGAGAAGAGTGTGATTAAGCATGCGCAGAAGAGTTTAACCGTGTTG
AAAGTAACGCTGACATTTTTTGTGCTATTACAGACTGGTCGAAGCGCTGGAACCGCCTGCAAAGAAAATTAAAATATCAGAAGCCACGCTGAAGGCATTG
GAGTCCAAACAATTAGTATCTGGGAGCACGTCCAGACCGACGAGAAATCCAAGTCGAAAGAGGAGTCGAAAGAAACCTGCTGCACCAGCTGCAGCACTTC
CTGCAGTCGCGACAGGTCCGTTAAATCCTCCTAGTGACGCCTCAGCGGGTAATAGGCAGCAGGTGAAGTCACGGTCGAAGCCGGCAAAGGCTGGCAAGGC
GAATGGGAAGGCGAGTGATAAACCCGTGACTACCTCAGCTGCTAAAAAGAAGACGGCGACTGCCAGTAACCGGACGAAGAAAGCGACAGCCACAACTACC
AAGGCAGCAACCAAGGTTGTGGCCAATGGCACGTCGAAAGCGATCATTTCAAAAACAACCAAGAGTGCCCAAGCTAGCCAAAAGCCAGTGGTGCCTGCTA
GTAGCGCAAAGGCAACGAAAGTTGAAGTGGGAATCGAGAAGAACCGAGCTGGGGGGGAGGAAGATCCTGGCAACGAGAGCTCGTCTTCCTCATCCTCGTC
TTCCTCTTCGTCGTCTTCTTCTTCTTCGTCTTCTTCGTCAGTGTCGTCACGCTCGTCAGCGTCCAGCAGCTCATCTGACAATGACACTGGTCGTGACGAC
TAGACGCACAGAGCTGGTTGGGCTTAGCAGAACCGAAAAGTTTTCGCTTAATTTTTAATGCTACTACCGTACGCGGTTCTCACAACACATTCTGCTGATC
TTTCTTCACCTCACCTCGTCTCACCTTCGTCAACTCTAGGCAGTGCTGCCTGCTTCTCTGCCCAGATATTTGCTGACTTTTGCCCCAGCTCGAACAGTCG
ATCCAGCACTTCAATCTGCGGTGGGAAAAGTGCAAAGCGAGCCAATTGCATAATCGTGAACGGGAAGTCCGAGTCGATGGACGGACTGATCTCGTAGTCC
TCCCGACGTAGTATGTGGGCGTGGAAGGCGCACACCTTGGTGTATCCCGGTACTTCCGGCACCAAAGTGAGGAGACCTCCGTCCACGTGGTACTCTCCTC
GAAAGACCGACGTGCCCCGCCTCGCCAAGTACCAAGGCACATAGCACGATGCAATGAGCGCGTCGCACAGATCCTCTGTCGAGTGGAAGTCGTCGGTGAG
CACCAGCGCTCTAGCCGGCCACATTTTCTCCGTGGCGATCGTGAGGCGCTGCGCCAGCGTCTCCACGGGCAGGTCGCCGAACTTGGTGTGGAAGATGGCG
CGCAGTCGCTCCTCGAGCTTCCAGACGGTGCCGTGGCTATGGCAGAGTCTGGCCATGGCCTTGGTTTCCTCGAGGATGTCGCGCGTACTGGCGTTGGCAG
CCAGACTCAAGGCCGCAATGGCGCCTCCTGAAGCTCCGGCGAACTTGGAACTGGACTGGATGTATCCGGCATCCTGGAGGCCCTGCGCCACACCCAAGTG
GTACGGGATCAGGAACCCGCAGCCACTGAAGCTGAAGCTGTGCG