Description :
From Genome Similarity Track
Location :
Scaffold_1548:510- 4259
Sequence
3749 bases(100 bases per row)
ACAGTACCGCGGCAAACAGTGCGTAATCCTCGATGAACCGGCTATAGTAGTTTAAACTGCCTAAGAAGGATTGCATCGCTCGTAACGACTGTGGGAAGAA
CAAGTCTGCTAATGAAGCCAGGTCCTTAGGATTCGCCTTCAATCCCTCCTTAGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTC
TTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTTCGCCGGGATTAGAATGT
CGTCGATGTAAGATCTGCGTCCTAGCACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATATACTTCCGTATGATCTTCCCCGGATCC
ACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAGAGAGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGCGTTCTTTAATCCAAACGGCATCCGG
TTCCACTCGAACAGTCCAAACGGTGTGATGAATGCAAATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGC
AGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCTAT
ACACAGACGTACATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCC
TTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTC
TGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGC
CCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAATGGTACCTCCGGGATCACCGCCATGCCTTCCCCAGATCCTCGGCGTGTAGAT
CCCCGCCTTCATGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTCTTTCGCCTGGCGGTCCTTCTGT
CTTCGGGGAATCAGGTACCCTGGTATCAGGGAAACCACCAGTTGGATCTAGTCGGTCCTCTAACGAGTTTAAGTCCGACGGTTCTGGTTTGACTAGTGTT
GCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGGAAGCCTGGATCCACTTGTGGATCAGCGGGATTCGGCTGTTCGGCTTTAGCCCTCTGCAATC
CTTCACCCACCGACCCTGCGCTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCCTTGCTTGGATCCCAACCCGTCGATCCCT
CTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTA
GTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAACCATCGCC
CGATCTCCTCATAATGGTCCAGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGACCCCTGGATTACGGTAGGTACCCA
TTTCTCGCCCCGAATGACCCGCAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCC
GCCCTTATGATCCTCATCTTCGCTCCATACAACGGTCGCCGTCCACTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCA
ACCTCACTCCGGCTGGTACCATGAAGTCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATACACCAAACAACCTGT
CAGCGTGATCTTGATTCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGGCTTGGATCCGACTCCCATCTACTTGGCACCCAACC
TTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTC
TGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCGAACATCCTCAGATCCACAGGATCCAGTGAC
CAGACCGACCTTAGGTGGATCTGCAGTGACCTACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCTCTTT
GTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGACCTTTGGCAACTGACACTTCATGTAGATCACGTGTAT
TATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTTACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAA
ACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATT
CTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACA
GACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCAAACACCTGACTTGTGCTGTCCCATCCATGAGATCTCGGGATCTGTAC
ATCCCACGGTCTCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACCCGACGGTAATCTT
CAGGGTCGGAGTCCAAACCGTCGGATCCTGATTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGATCCTT
TTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGT
CGTAACAGGATCAGCCTGTCGGCCAGATCCATGTCTCCCACCGTCTCAATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCTCATCCTTGATCT
TCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGA
CACTCCCAATCCACAATACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCGGCCTGGC
CCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGT
CCTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGA