Description :
From Genome Similarity Track
Location :
Scaffold_824:510- 2548
Transcript NameFunction/comments
Phypl_g11157hypothetical protein PHYSODRAFT_512708

Sequence
2038 bases(100 bases per row)
AGCAATAATGGCATCTACGTTCGCCATGAGCCCGATCCAGCAGCATACACAGACAAAGTTCTCGGGGACGGCGCCAATTGATCCGGCTGCTgtacgaaga
cgacgaaaaGAGACCGTGAATGAACGCGTGGAGCATATTCTGCGAGGGGCGTTGCGTGAcgctgaggaagaagcgctgcaggaggtaGAAGGAGACCCAG
AAACCCGTGGGCGTGCGTTGCAGCGGTCCCATCAACTGGCTTCGTTGTACACAACGTCGATGGACAGCAAATTCCTACGCTCTCGAGCGAaacgagatgc
agcgcttGAACGTAGTAAAGAGGTGAAGCCTCGACGAGACTCCGAAGGGTTCGTACCGCTTGTAGCAGGGTCAAATTACGCAGGAAGCGTGATCGGTGAa
ggcgacgagagcgaggagacCGACGACGATACGTTCTCTGTGGGGAGAATGGTGCTCGCTTCGCCTATCAAGTCAAGTAGCGTCAACTGGGGCGGAGTCC
CCCGTGTGTCATCTCCTCAATCGATGGTGACGTCGCCTgtgaagctctcgaagccGTGGTACGgatgcaccaccgccacTTTGAAGGAGCCGCTAGCACC
AGGCCTCACTTTGGATGCAAAGCTGCGTCGCTATGGCGCTCGTGGCACTGCGAAACTTCTACGGTCTCACGAAGCTCTCGAGCCGCTTGTCAATGAATTT
GTGCCGGGAGTTCGCGGTTCGCCATCGCTTTGGCCGCCCGAAACGTGTCACCCGATGGGGTCTCGCCTCGCAGTGACGATgactcgctgtccgtcgtcTC
CTATTGCAGTTTCCGTCCAAGTTTGCGGCCAAGACAACGCGAATCGTGTCGATCCCTGTCCGTCGTTCACAGATACACACGGAACTttgcagcagaaggc
ggcgcagaaaCTCCAGCGAGCCTACAGACACGAAGCGCAGGTCGCgaaggagcagcaagcgcacAACCAGCGAGAAATGTCCGAGTGGCGAAGGCGCACA
CTGCATTTCGAACCTTCGTCTGAGCTCGCAGAGCACCGCGAGCAAACGAAAAGCGACCCGCAGCTCCGCTACCGACGCACGCAAGCTTCAGCCATTGTCC
AGACGCCCGGGTATTCTcccgagaagcagcgcagcaaaGAGGCGAGGGAATTGAAGAAAAGGCGCTTCAAGCTCCGCTGGCGAGCGTTTGCAAGGCTTCT
CGACGCCATGCGGCGGACACCGTGTCGACGGCCGGTGCTGCAAGATATGGAGAAATTATTTGCGTTATCTAGAGAGCTAGGCGCACTCAATGCTCTCGGG
TCGTGTACGCTTTCTCGGTCTCAAttcacgctgctggtcgccaGAGAGTTCCCGTTGTGCGAACTGAAGCACGTGAACCGCTTGTTTTCTTCGTACGACT
GGGAAATCCGCGACTCGGTCGATGCTCGCATCGTTCTTGGGACGATACGAGCCCTGCGCGTTCAACAAGGCGAGTCTGTCGAACTCATCTGCGCTTCACT
ACGGGATTTTGACGGCACGACGGACTCAAACAGCAAGAACACGGAGGTGCTGGTCTCGGACGGAGTTAGTCTGACTAAAGCACTGTCGTTGTGCTGTGCt
agcgacgaggaagagaaggaaATGCAGTCGAGAGCTGGTGCGCTTTGGACCAAGAGCCTCTCCTGGCAACGTCAAATTCTGTCTCGACGTCTGCACGGAG
GTGTACGACATGACGTGTGGAAAGTAAACCCAGGCACCTGGAGCAtcggtagcagcagcgcaatGCCACGCACAACGGACTCCGAGGACGACGCTGTCAG
CCGAAAAAGTGGCGAAACAGGCCGTGAAGGAAGTGAAAAGGGTGgtgacagcgaggacgaagaggacagCAAGGAGGAAATCCCCGACCTCGTGCGGCTC
GTCGACGAATCTCGCGTGCCCGTGAGACGCATTCGGGCGGCGCTCAAACGAGAACGAGAGACTTTAGAGCTTTTCACGCAACAACTtttgcagcgtcgac
acgaATCTTTAGTTGGTGCCAGCACGCCCTCTCCTAGG