Description :
From Genome Similarity Track
Location :
Scaffold_1535:51- 4554
Transcript NameFunction/comments
Phyag_g10897hypothetical protein

Sequence
4503 bases(100 bases per row)
CCGATAAACGCACGTGGCCTGACCcccagcaacaccagctaACGGTACATCGCGGCGATTGGGAGTTGATCCGCTCTTCTGAAGCATTTTCAGTGGGATG
GTTTCATCGTCACCTGCGCTGCACTCGTGACGCCTTTGAGGAGATTTGTCGTCGGGTTTCAAGTTGCTGGACATTTGTGATGCCCCCTCTGAGTGCGAAT
GCAGAGGTGGACCTCCTCACACACGTCGCCATAACGATGAATTATCTGGCTCACGGTGGACCTATGTACAAGGCGGGAGATTCCTTCGGTCACGGAAAAA
CAGTATCATTGACATCGATCCATCAAGTACTGCTAGTGTTGAATGCCTGGGTAGAAGATACCGTCAGGACTCCGACCAGTGAGGCAGAATGGGGTTCGAT
AAGCGGTGATTTTGAGCATGTGAGCGGATTGCCAGGTGTTGTCGGAGCTGTGGACGGGTGCTTAATTCGTATCAAACGTTTTGCAGAGCTTGACGGTTGG
TACTGTCGGCGTGGATATCCAGCGTTTAATATGATGGCTGTCATGGATCACCGACAGCGTTTCATGGCATACTCGCTTCGCAATGGAGCCCAGAATGACA
AATCCGTTTTCAATCGGTCCACGTTCGCGCGCGGAATGGCAGATATGATCCCCCCTGGAACACATCTAGTTGGTGACGCAGGATATCAGTCGCTGACAAA
CGTGCTCATCCCGTGTCCGATTCGTGCAGACATGTCGAGAGCTAATCGTTGGTACAACTTGGTGCACAGCCGAACTCGAATTGCAGTGGAGCAAGCTTTC
GGGAGACTTAAAGGAAAATTTAGGGTGTTCAAGTCAGATTTGGCCCTGCAAACGCCGACCGCAATGACGTCAATCGTTAAAAGCTGTCTAGTGCTTCACA
ACTGGATAATTGGCTTAGACGGAACTCCTGCTCTATCCCCTGTGGCAATTGAAGACTGGATGGAGTTCGATCGTGTGTGGTGGGCTACAGAAGAAGTTAC
GGGACACGATATGCCAGCTCAAAGAAAACGTGATGCGATTAGGGATTACTTGTTTGCTCGTCAATTTTAGCAGCACTGGGAGGACTAGTACTAGAAGCAG
TAGCACCAGAAGATCGCAAGAAGGTTAAAATGGCGGAATTCACTTGACGAGATTGATCAATCGAAGCCTGCATCGCCTCcagcgtttgctgctgctcagc
aatctgcttctccataCGCGCCATCTTGGTCATGATTGGTTGTAGACCTTCGCCACCCGTGCTATTAGGTGCGTTCAGTCGCGTGCTGAGCGACTCGGCC
ATTAAAGCTACTGCGCCAGCCAAGTCCATTTTGCGCTTGCGAGCGTTGCGCTTGGTGGTTGCTCCTtcagtgacgacgacacgtTCTNGGATCCATGCCG
CAGCCAGCTGGGATTTGCTCTTCGAACCCCTGAAGGCAGGGGCATACTTGTGCATCCGAAGAAAGAGAAGTGACTCCACAAGAGGATCGCTCCATTCCAT
GCGCTCCTCGGTGCCTGGAGCCGGAGCTCCTTCCATGATTCGTCCCCGGACAAATCGTCCGTACGCTCAGCTCCTAGTCTGAATTGTTGTCAATGAGAGG
TCAAATGTGATTTTCTGAAGTAGAAAAAAAGGAGACTGCGACCCGACTCCACTTTTTTGCCAGAAAAAGAGCCAAAAATTGATGAGCTGCGACCCGCCtc
ttatcgacgaattcggtaaGAGCTTTGCACACGATCTGTTACTGAGTTGTTCTGCTGCACATCTCGCtcgcagctcctcgatctgaCGGGCCACCAGGCG
AGGGTCATGCTTGCGGCTTGTAGCGGGGTGAATTTGAAGACTAGAGGCTTGAGCGAAGAACAATAAAAAGAGTTGTGTCGTATTGAGTTAATTGTCGGCG
GTCTCCAGTGCCATCCATCTATACACCTGTCGAAAATGATCGATCAAGTGCAGTAGGGTCATGTGATATTACACAACATGTGTACCTAGCTTTACTGTAC
AAAATATGTAACTGTGTCACACTTTGGACACATCACCTCTACATCAACAGCCTCTCTGTGTCCAAGAGAGACACGTTCTTATCGGGCAGCTGTTATGCAG
ATGCTTTTACAGGACGACTCGTCCGACGAGCGATCACTGCGCTGTTGAACTCGCCAGCTTGAGCGGCTTATGCCGAGTATAAGCAGCCAGGGAATCTGCA
GACTCTGCCACTAAGTGCGCACAACCACTAAGACGTAGTTAATTGCACTTGCTCGCTCCACAATTTTCAAGCTTCTGTGCACgcgcctgcagcaacttca
gcataGTAGTCAAGCAAATCGAGGTACGCTACTCCCTTCGGTGGTCGACTGTGCGAGACTCGGCAAAACTACGGTTTTGGACAATTTGGCAAGGATCAAT
GTGAGCCTGACGCCACAATCTGGGCTAGTGATCCGAGTGGGCTTTGTCCTGCTCGGTGAGCGAAACATATTCTCCTTGCTGATTTCCTAAATTGTATGCA
GCTGATTCTGGCATCGAATGGCCACTAATGTTTGTGTGTATTCATTGTACTGACACATTATTTTGCATTTTTTACGTAGATGGCTGTGAGCCGTCGAGTA
TCTGTCCTATGTCAGCACCAGGAAATGCTGGGAAATAGGTACTCGATGTGCGGGTTGTTATATGTGAATAACAGTCTGCAGCACCGTGACTTTCTCACAC
CGACAACCATGAAGCCTGTCCTCGCGCGGTTGGCCCAGGTCAGGCCGACCGAGGATCATGGTCACCCTCAGTATGGTGCTTACACCATGGATGCTCTACA
AAAAGCGTTGCAAAAACTGCAAAGACAGCTGGTATTCATGAACAAGAAGTCCAGCTTCAAGAGCCGGCCTAAGCGACCAGGGGCCATCATCAGGAGCCGC
AAACCAGCGCTCCTGATTGTCGGCCAGCGACCCGGGCAGCAGGCAGGTACTTGGCACTACATTGCCCGTGCCTGGGTCGGCAACAAATTCGTTTTCATAG
ATTCCGATCGCTATCATTACTTTCCCAACAGAGAGGATCTGTTGACGGGTTTTTTCGAGGCTATCGATGGTGTCTATTCGATTGAGGACGTTCGCCGCAA
AGGCAAGAAAGTGTAAGAAATTGAATGGTACTTAGAAACTGGTACAATAAATTGTTTTTGTTTGACTTTGAAATTTTGTTTCCATTGTTTTACCTGTATC
GTTGCTTCTTGTGAGAGTttataaaaaaaaattgtGGTTTTTTTGCAAGGAGTTATGAATTGTGACAGTAACTTGTGGATGTCTCTAAGCCTGGTTTTAC
AAAGAGCATGTGTACTTCTAATAGCGTATTCTCTGACGGTTTACTTCACAAATGGTTGTTTTTAAAAGGTACAATTAAATGGAAGTTTTAGCAATGGTTT
TAAACTTCTTGTCAGATTATTTTGCATTCTCTTTTGCAGTTTTGTTTTTTGTTTTAAAGAATATAGACTTTTAGAAACTTGTTTGTTAGAACAAGAAGAG
AGCTTTTATTACCGTGATTTGCACAGTGCATCGCGTAATTTTAAGAAAGTTGGCTTTGTAAGAGCCTTCGTAAAAATATCTGCAACCATTTCTTTAGTGT
TGCAGTACATGATCTCAAAATCTTTTCGTTCAGCTTTTTCTTGTACAAAACAGTAGCGAATGTGTATGTGTTTGCTTCTACCGTGGAGTTCTGGGTTATA
TGAGAGTTTTATACAGCTCTGATTGTCCTCAAAAATAGTAATGACATGTAGACTCTTGTGATCTAGCTTAATGAGTTGGAGTTTTAGGAGGATCGCTTCC
TGCATGCAGTAAAACAGAGCGATGTATCCAGCTTCTGTCGTGGATAGCGCGACTGTGTGGTGTTTCCTAGACTGCCATGAAATCGGACTGCCACACAGGT
AGGTAATATATCCTCCTACAAATCGACGTGTGTCGGGGCAGTTAGCATAGTCAGCGTCTGAGAACGCAGTGAGGTAGTGCTTTGTTTTATACTGCTCGAC
ATTTTGTCGTCCTCCTAGCGTAATGCCGAGGTTCCGTGTGCCGTTGAGGTATCTAAAGCCTTTCTTAACTGCATTCCAGTGTGCTTTGTCTGGGTTTGCC
AGGAATTGACTTAATTCTCGCAAAAAAAGGCAAGATCGGGTCAGGTTCCCatcatcaagtacatgaGGCTACCGATTGCCTCTCTGTATGGGATCGCTTT
CATCTCATCTTTTTCTGCATTCGTTTGCGGGAACATAGTGAATGATAGTTTGACACTCGGATACGTGGGTGTGGCCACTGGATGGGCGTTGGGATGCGAG
AAGCGGTCCAGTACTTTGGTAGCGTACTTCTCCTGGTGGATGAAGATTGATCGATTTTTACGGTCTCGAACAATCCACCATCCTAAGAGGTACTGGGCTT
CGCCCAAGTCAgacatgttgaagcgcttcttgagaGTGTCTTTGATATggttgatgatgttgagTGTCGGTGCGATGATGAGGAGGTCATCAACGTACAC
AAG