Description :
From Genome Similarity Track
Location :
Scaffold_803:51- 2227
Transcript NameFunction/comments
Phyta_totarag10795hypothetical protein PHYSODRAFT_355818
Phyta_totarag10796hypothetical protein PHYSODRAFT_318393

Sequence
2176 bases(100 bases per row)
ATAGTCAAGCTCTTGCGGACATCTGCAGCGTGGTGACTAATCCACAAGTGATCAGTCACCGCTGTATCCCAAACTGCAACTGGTGACTaacatgtagcca
tcttcttTGACACACGAAAACgacatgtagccatcttgcaAGGACCCATTTTATGATTAGTGGCACTAGCCAGAGGTCTGCAAGTATACAAATACTAAGT
TAACCCTTCTCAGTGTCACTGATGCCACTCATCTCGCCACGGTCGACACGTGAACCACAGCCACACATACGTAATTCATGTTGTCAATTGCGCTGCGTCT
CGGCCGCCGCGCCTTGCTTCCCAGCCGCCATGAGTTGATGCTGCGCAGCTTTGCCAGCACTaacgccgctgctggcttcTCGTACCCGGGCGCGCGTTCG
CTGGAACAGATTGtgaagctcgagctgctggagaacgagcaggCGCCGCAAATCCGCCGAATCTGGGAGGAATTCCACGccgacaaggacgacgcagTGG
CCACCACACTGGGAGCCAGTGAGTTCCAAACTCTGGTGAAGCGTGCCGAGGCGGCACCCTATTTCATCTTCCCAGTGTACCGTCAGGAGGGATTCTTTAA
CATGTTGTGCCAATTCCAGCAGTCGTGCTTCCTGGTCACGTACCTGGAGGCGTTCAGGAAGAACCCGAGTGCTGCACCGCCCTGTGTTGCTGTGTCGCTG
TACGACAACCTGTTagcggagaaggagcttACTCTTGTCCGTGCTGATGTCATCAAcatgctggacaagaaggagtcgcagctcctgctgcaacaaCTGC
TATCCAGCTACCAAGACGACAAACTTTACGAGCATGTGGACACGTTCAACAACAAGCCCGACCAGTTCGACTTTGAAACTTACcgattgctgctgaagga
cgTCACTGAGCGAGAGGAGGCGTAgactgctacatgtagtgtggTGGTAGACGCATGTTGAACAAAAAATGTATCTCGTGTCTTAAAAACCATATCACTC
CTCTCTCTCACTCTGcccttcttcctctccagcTTTGCCTGGCCATGGCAGGCAACTATCGTCTACAGATGTTCCCTTACTGCTGGGCCTTCTGAGCCTG
AGCCTCCTTCCTCTTGGCGTGCTCCGCCTGGAAAAGCACAAGAGCCTGCTGCGTCGTAGCGTCAGCCTCAAGTCCCAAAGCCTGGTACTCAGGAGCGTGT
GCCTGAGCGAAGCCCTGCAGCGAGCCCAGGAAGAactccacctcgtccacctcatccagcagacTAATGTAGTCCTCATCaccctcgtcgtcgtagccGA
ACTGACCCTCAGCCTCCTCACGCAGCTGACGCAGGATGGCGTAGTACTGATCGTCCACCACATCCTCAGCGTCCTCGTTCGAGGCGTAGCCGCCGTTCTC
CAACAGctcctcaagctgctcaccctcctcgtcgtcgccctcggCCTCCTCGCCACCCTCCAGGATGCCCGGAGCCGGGTTCTGGATGGACTCGGCAAGC
ACCTTCATGGCAGCCTGGatcagctgcttgatgtGAGGGCGCAGGGCAGCCGGGATCTTGTCGGCAGGCGCACGCAGAATCGACATAGCGCCCAGCACGA
ACAGCTTGCGGTCCAGGTAGTTGTCGTACCGGGACAGGTCGCTCAGCCAGATCTTCAGAacaccatcagcagcgccgagGGAGTTAAGGGTTTCAAGGGT
GAGCGCAGGGTTGTAGTGCAGCAGACTGCCGAACACACCCAGCAGGTTGCGCGCAGTGGAGTCCACAAGCGGCTCCGCCAGCTTGGTGCACACCAAGAGT
GTGATGGGAGGAATGCactcgtccaccttgccgaacaggttgtgcagcagcgagtacAGCAGGCGGCACGCAGCGCACAGGTCGATCTCCTGCACGCTCT
TGCTCTCGAACACCGTCTTGGCCATGTTGAACACAAGCTCCAGGTAACGCACGTTAGCTCCAGTGGCGGGGTCAGCTGCAGAGCCAGACAGGAAGCCCTC
GATGTCGCGGCCCACGAAGTTGTCGATCACCGGCACGAAGTTCGTCAAGTAGTCCGACGCCCAGTCGTTGAAGCTAACAAAGATGAGCGGGAAGAGCTCC
CAAAGCTGGGGAGCGATCTTATGGCTGTAGAAGGCCAACGAGCCCAGGATATCAATGCCGCTCTCCATGTACTCGA