Description :
From Genome Similarity Track
Location :
Scaffold_3086:51- 1914
Transcript NameFunction/comments
Phyta_totarag15060hypothetical protein
Phyta_totarag15061hypothetical protein

Sequence
1863 bases(100 bases per row)
ACGAAATTCTGCGAGGGCACGAGGACGTGCTCCCGGACGACATCCCTGTGGAGCTCCCGCAGGACAAGGGCATCGTCGTCTCTGATCAACGACGTGAAGG
CCGCGTATGcgcacgacgcagacgcgaaAGAATGCGTGACTACGTGTTAGCACCTTGTGATAAGGCTCGTCAGAAGATGTCCCGCCACTTACGCGCTCGT
GCACATCTTTACCGGGTGCacgacgacttgctgctgtacagcgctgtcgacgacaATGCGGATCGCATTGTCGTGCCCAATGATCATGACCTGCAACTCA
GGTTCATGTACGAATACCACGATGCCCCCACGGCAGGGCATCCGGGCCGTGAGAAGACGTACGTTCTCCTCACGCGCGACTTCTACTGGAAGCACCAGTA
CAAATGGGTGCGCAAGTACATTCGTGCTTGCGAAGTATGCCAGCGCGTAAAGCCTGCTCCATTCTCGCAGGCTCCACTACAGTCACTCCCGACTCCGTCG
GAGTGCTGGCAGTCCATCTCGATggacttcgtcttcgtccttcCGCCTGGTGTCACGCGGAGGACTGGTGCAGTGGTCTTTGTAGACCGTTTCAGCAAGA
TGGTACATCTTGTTGAAGTGCCGGCTGAAGTGACAGCCGTGCAGACAGCACACTTATTCGTGGTCATGGTGTTCAAACACCATGGCATTCCGCACGACAT
CGTGTCGGACCGTGACCCGCGCTTTACAGCATGGTTCTGGCAAGAAGTGTTCTCACTTCTTGGAACAcagctgtcgatgtcgactGCGGATCATCCGCAG
ACGGACGGGCAGACCGAGCACGTGAATCGCGTGCTcggcgacgtgctcaagAGCTACGCACACTCGTTCCATCACNGACAACAAACAAGAACACGGTGTC
TGTGCCGGGCACATACGCCGTGAAGGGGCACACACAGGCCGGGCCTGCTGCGAACGACAAACGCGCACACGCAGGGTTTGTAGCAAAGCGCATACACGCA
CATGCAGGGCCTGTAGCAGAGATCAATAACCATGTTTCTGCGCAGGACGCAGTCGATCTGAACAAGTCATTCAGCTCGGAAGCAATGGAGTTTGTCCAGC
NCGACTCCATCCGACGTTCTATGTCGGGCGACTGAAGCcgtacgtgcagcacgagtcaCCTAGTGTAGGTGACCCACCGAGAACGAGGGAGAAGCAGGGG
CGACCTGCTTCGTCCCAAGCTCGACTCTCAAGTTCGAGGCGGTCTGCGAAACCACCGCGAGTTGAGCCTTCAACAGGCTTATCTCCTGCTTCAGAGCGGC
GAACTCAGCGCTCTGAAGCGTCTCCACGGCCGACACTNTCCGGAAATGGTGAAGGCGTACGAAGTCCACCATGTACTGCAGGCGTAAAGCTTGTACGAAC
GCTGTAGTTGTCTACAACGTTCGGAGCCTCCTGTGCTTGCAGACTAGCACGGAGCTCACGAAGACTTTCAGGTACACGCACGCTCGTGTACCCGTTGACA
TCACTGTCGGTCAAGCGTGCTACCCCGGGGTGGCAATGTACGCACGGCATCCGGGCGGGCACGGCGCAGGAATCCCCGCCTCCATGGCCTCGCCATACAA
GCGATCTAGCTTGCCgcgcttcgagaacttctcgaagCGTTCCCGTGCTGAAACAATTCGAGCACGGTATCCAGCAGGATATTTGTTGAAGTTTTAAACA
AAGGCGTTCCAACTTTGGTAAAGTGCCTGCCACTCAGGCACTTTACTCTTGCGAGAAGTTCTCTTGCTCGCATAgtgtcggagctcatggaaGAGCCCGA
CATAGTAGTCACGCCTTTGATCCATTACCTGCAAGCGCTCGAGTCGTCGTCCCGAGGACGGCG