Description :
From Genome Similarity Track
Location :
Scaffold_6:509974- 511488
Sequence
1514 bases(100 bases per row)
CTCCCAATAGCCGCGCGCTTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAATTCGTCCACTTGGCGCAAGCTAGAGACCTTGGCA
ACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGGCCTGCTACCTGGATCTAGCGACGTCTTGTTCACAAATGCATAAATGCAATACC
TAGAACGCTCGACTCGTACCGGATTCAAACCTGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCTGGTAACATCCCTCTGTGCTTGGCTGGATCA
AACCATTGGCGGATCCGGTTGTAGAACTCCTCCATCGGGCACTTGCCAGCATCGTGAATCTCGCCGTAACCGCAACACACATAGAAACAGTGCCCCCGGG
ATGACCCTTCTTTCCACACTTCTCACAAACCAGATGCTTCCAACATCCAGCTTCTGTGTGCTGCACTGCGAGCACCTGATTCGTCCTGTCCCGTCCATGA
GATCGCGGGATCTGTACATTCCACGGTCCCTGGGTAAGAAATCGCCAGTGCGGGCGTTGTCTCCAGTCTTCGCCGTACGATCGTTGGAAGAGGTGAGACA
GACTCTGCGGTAATCCTCTGGATCGGAGTCCGAACTATCGGATCCCGATTCAGTTCCTGAGTCGGGCGCCAGGACTTGGTGGACACGTCGAGCTGGGGCC
GTGGGCGTCGGAGCTTTTTGGCGATACTTGCCGAATCCGACAGCTGTCTTCTTCTGACGGTGTTTCACGCGATCCGCAGTACGCAGTACTTCTTCAAGCT
CATCGGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCGACATCTCCCAACGTTTCGATGAAATGATCCACGTGTTCCCATAGTACCTTGTA
TCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACGTTTAGCCGATGAAGATATTCTAGCGGAGACTCGTCCTATCGGCGGCGAGCATGATAG
TATTGACACCCTACCGACGCCCCCAATCCACAGTACTTCGTTTGGAAACTGCGTAACATATCCATCTACTTCTTCCTAGTGGATCTGCCCAGCTGCCGAT
ATCAGTTGCTGTCTGGCCCCGCCAGCAAGTCCGCAAATGTCAGACACGTTTCGGCATCCGACGCTTGATCTCTCATGAGAGCTGACTTGACTTTGCTGAT
CCATGTTCGCGGTCGGTCTTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGGTCATGGACGATCCCTTC
GTCCAGGCTGCAGCTGTTACTACCGCCGCTGGCGAGGGGGATGGGACGTCCAGATCATCTGGGTCAAACTCATCATGAGAGTTGTCTCCCTCCACTGACT
CCATTTTTACGTCTCGTGCTCCATGTTCATGGAGCACTTGCATTCGCGGCTTGGGTGACCTCATGCCTTGTTCGGCCAGGAAACGACTCATCGCAGCTTC
GAAGTGTCGTTGCA